Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

22 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The effect of TuMV on translation initiation in Arabidopsis

ABSTRACT: Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.] pathogen infection: TuMV inoculated - RNA fraction: polysomal RNA(3-replications); pathogen infection: TuMV inoculated - RNA fraction: total RNA(3-replications); pathogen infection: mock inoculated - RNA fraction: polysomal RNA(3-replications); pathogen infection: mock inoculated - RNA fraction: total RNA(3-replications)

ORGANISM(S): Arabidopsis thaliana

SUBMITTER: Sudhansu PLEXdb Curator

PROVIDER: E-GEOD-20278 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

The effect of TuMV on translation initiation in Arabidopsis

Project description:Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.]

2011-03-11 | GSE20278 | GEO

Blumeria graminis fsp hordei effects on translation initiation in compatible and incompatible barley

Project description:The goal of this experiment was to examine the effects of Blumeria gramins f. sp. hordei (Bgh) on the host process of translation initiation in both incompatible and compatible interactions with Hordeum vulgare. This was done by using Bgh isolate 5874 (AVRa6) on the resistant host CI 16151 (Mla6) and fast-neutron derived, loss-of-function mutant m9472 (mla6). Plants were grown 7 days in the greenhouse and then inoculated or non-inoculated and transferred to an 18°C growth chamber with an 8 hr dark, 16 hr light photoperiod. At 32 hours after infection the tissue was harvested and immediately frozen in liquid nitrogen. From the same tissue, total RNA was isolated using a Trizol method, while polysomal RNA was isolated by sucrose density centrifugation. Three biological replications were conducted. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is BB72 at PLEXdb.] genotype:CI 16151 (Mla6)-pathogen infection: Bgh isolate 5874 (AVRa6)-RNA fraction:polysomal RNA(3-reps); genotype:CI 16151 (Mla6)-pathogen infection: Bgh isolate 5874 (AVRa6)-RNA fraction:total RNA(3-reps); genotype:CI 16151 (Mla6)-pathogen infection:non-inoculated-RNA fraction:polysomal RNA(3-reps); genotype:CI 16151 (Mla6)-pathogen infection:non-inoculated-RNA fraction:total RNA(3-reps); genotype:CI 16151 m9472 (mla6)-pathogen infection: Bgh isolate 5874 (AVRa6)-RNA fraction:polysomal RNA(3-reps); genotype:CI 16151 m9472 (mla6)-pathogen infection: Bgh isolate 5874 (AVRa6)-RNA fraction:total RNA(3-reps); genotype:CI 16151 m9472 (mla6)-pathogen infection:non-inoculated-RNA fraction:polysomal RNA(3-reps); genotype:CI 16151 m9472 (mla6)-pathogen infection:non-inoculated-RNA fraction:total RNA(3-reps)

2011-03-11 | E-GEOD-20279 | biostudies-arrayexpress

Arabidopsis cold regulated transcriptome, translatome and CSP1 RNA regulon

Project description:Transcriptome, translatome, and CSP1 RNA regulon analysis of 25-d-o Arabidopsis rosettes exposed to 12h low temperature (4C) treatment. 38 samples, 3 genotypes (35S:HF-RPL18, 35S:AtCSP1-FH#11, and atcsp1-1), 2 conditions (non-stress and cold), 3 RNA pools (total, polysomal, and CSP1 associated mRNAs), 2-3 biological replicates

2013-03-31 | E-GEOD-38030 | biostudies-arrayexpress

Translatome of floral buds, in vivo pollinated pollen tubes, and in vitro cultured pollen grains/tubes from LAT52-HF-RPL18 Arabidopsis

Project description:Little is known of the transcriptome of in vivo-grown pollen tubes, due to the difficulty of collection of pollen tubes elongating within the maternal gynoecium.We obtained the mRNAs undergoing translation (the translatome) of in vivo-grown pollen tubes from self-pollinated gynoecia of Arabidopsis thaliana(Col-0). Transgenic Arabidopsis plants (LAT52-HF-RPL18) harboring an epitope tagged ribosomal protein L18 driven by the pollen specific promoter (ProLAT52) were used for mRNA-ribosome complex isolation. After collection of polyribosomal (polysomal) complexes from self-pollinated (in vivo), unpollinated styles (buds), and in vitro-cultured pollen tubes, the actively translated mRNAs (the translatome) were purified, amplified to antisense RNA (aRNA). These aRNAs were hybridized to microarrays.Three independent biological replicates samples of aRNA from Bud, in vivo, and in vitro polysomal mRNA (translatomes) were hybridized to GeneChips to produce CEL files.

2014-02-01 | E-GEOD-43299 | biostudies-arrayexpress

Translational control in early adipogenesis

Project description:In obesity, adipose tissue expands by increasing the volume of existing adipocytes (hypertrophy), increasing the number of small adipocytes (hyperplasia) or both. Much is known about transcriptional control during adipogenesis, including early events. However, translational control plays a pivotal role in many dynamic processes and we presume that it is also important for the control of adipogenesis, especially in the first hours after hormonal induction. By use of ribosome profiling we identified 43 genes that are up-regulated and 2 genes that are down-regulated during the first six hours of adipogenesis in 3T3-L1 cells. Interestingly, we found Ghrelin to be down-regulated. Up-regulated genes comprise factors that are nucleic acid binding (Cdkn1c, eIF4b, Hsf1, Irf6, Myc, Plekhn1, Polr2a, Rpl18, Rpl27a, Rpl6, Rpl7a, Rps18, Rpsa, Sema3g, Tbc1d22a, Tsc22d3), form part of ribosomes (L6, L7a, L18, L27a, Sa, S18, S15a pseudogene), act on the regulation of translation (eIF4b) or transcription (Hsf1, Irf6, Myc, Tsc22d3). Others act as chaperones (Bag3, Hspa8/Hsc70, Hsp90ab1) or in other metabolic or signals transducing processes. We conclude that a moderate reorganisation of the functionality of the ribosomal machinery is a very important step for the growth and expression control at the beginning of adipogenesis. 12 samples: 4 (0h, non-polysomal fraction; 0h, polysomal fraction; 6h, non-polysomal fraction; 6h, polysomal fraction) x3 replicates

2012-03-28 | E-GEOD-29744 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Label-free quantitative proteomics on Nicotiana benthamiana plasmodesmal proteome following viral infection

Project description:We analyzed the PD-enriched fraction from Turnip mosaic virus (TuMV)-infected Nicotiana benthmiana (N. benthamiana) by using label-free quantitative proteomics of which 100 and 48 were significantly increased and decreased respectively when compared with mock plants.

2017-10-19 | PXD006323 | Pride

Blumeria graminis fsp hordei effects on translation initiation in compatible and incompatible barley

2011-03-11 | GSE20279 | GEO

Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi

Project description:At 7 and 10 dpi with wild type TuMV or buffer (mock) whole plants (root not included) were collected and total RNA extracted for sRNA sequencing using the Illumina plataform.

2010-04-09 | GSE20197 | GEO

Polysome profiling RNAseq of cells transfected with an oligonucleotide targeting the ES6S region of the 40S subunit

Project description:Polysome profiling experiments were carried out to identify the mRNAs that have altered the translation efficiency (counts in polysomal fraction/counts in monosomal fractions) in the presence of an oligonucleotide targeting a specific region of the ribosomal RNA, to study the implication of this region in the translation of specific mRNAs

2019-12-10 | GSE129651 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data