Transcriptomics

Dataset Information

5

Expression data from Control or ShSuz12 rat Intestinal epithelial cells IEC-6


ABSTRACT: Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, Sigma–Aldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (Sigma–Aldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (Sigma–Aldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturer’s instructions. RNA samples from three independent experiments were used for microarray analysis.

ORGANISM(S): Rattus norvegicus  

SUBMITTER: Mylene Blais   Naomie Turgeon  Claude Asselin  Jean-François Delabre 

PROVIDER: E-GEOD-60003 | ArrayExpress | 2014-08-02

SECONDARY ACCESSION(S): GSE60003PRJNA257268

REPOSITORIES: GEO, ArrayExpress

altmetric image

Publications

The histone H3K27 methylation mark regulates intestinal epithelial cell density-dependent proliferation and the inflammatory response.

Turgeon Naomie N   Blais Mylène M   Delabre Jean-François JF   Asselin Claude C  

Journal of cellular biochemistry 20130501 5


Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial ce  ...[more]

Similar Datasets

2011-08-11 | E-GEOD-31354 | ArrayExpress
2014-02-08 | E-GEOD-54785 | ArrayExpress
2013-06-08 | E-GEOD-47745 | ArrayExpress
2015-08-04 | E-GEOD-54785 | ExpressionAtlas
2010-07-07 | E-GEOD-22344 | ArrayExpress
2008-11-01 | E-GEOD-13084 | ArrayExpress
2010-07-08 | E-GEOD-22343 | ArrayExpress
2008-06-14 | E-GEOD-6015 | ArrayExpress
2015-05-19 | E-GEOD-68984 | ArrayExpress
2018-07-09 | E-MTAB-6430 | ArrayExpress