Trypanosoma brucei
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA243315 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The nuclear pore complex (NPC) has dual roles in nucleocytoplasmic transport and chromatin organisation. In many eukaryotes the coiled coil Mlp/Tpr proteins of the NPC nuclear basket have specific roles in interactions with chromatin and defining specialised regions of active transcription, while Mlp2 associates with the mitotic spindle in a cell-cycle dependent manner. We previously identified two putative Mlp-related proteins in African trypanosomes, TbNup110 and TbNup92, the latter of which associates with the spindle. We now provide evidence for independent ancestry for TbNup92/TbNup110 and Mlp/Tpr proteins. However, TbNup92 is required for correct chromosome segregation, with knockout cells exhibiting microaneuploidy and low fidelity telomere segregation. Further, TbNup92 is intimately associated with the mitotic spindle and spindle anchor site, but apparently has minimal roles in the control of gene transcription, indicating that TbNup92 lacks major barrier activity. TbNup92 therefore acts as a functional analog of Mlp/Tpr proteins, and together with the lamina analog NUP-1, represents a cohort of novel proteins operating at the nuclear periphery of trypanosomes, uncovering complex evolutionary trajectories for the NPC and nuclear lamina. Whole transcriptome comparison between parental and TbNup92? cells
2014-04-03 | E-GEOD-56436 | biostudies-arrayexpress
Project description:The nuclear pore complex (NPC) has dual roles in nucleocytoplasmic transport and chromatin organisation. In many eukaryotes the coiled coil Mlp/Tpr proteins of the NPC nuclear basket have specific roles in interactions with chromatin and defining specialised regions of active transcription, while Mlp2 associates with the mitotic spindle in a cell-cycle dependent manner. We previously identified two putative Mlp-related proteins in African trypanosomes, TbNup110 and TbNup92, the latter of which associates with the spindle. We now provide evidence for independent ancestry for TbNup92/TbNup110 and Mlp/Tpr proteins. However, TbNup92 is required for correct chromosome segregation, with knockout cells exhibiting microaneuploidy and low fidelity telomere segregation. Further, TbNup92 is intimately associated with the mitotic spindle and spindle anchor site, but apparently has minimal roles in the control of gene transcription, indicating that TbNup92 lacks major barrier activity. TbNup92 therefore acts as a functional analog of Mlp/Tpr proteins, and together with the lamina analog NUP-1, represents a cohort of novel proteins operating at the nuclear periphery of trypanosomes, uncovering complex evolutionary trajectories for the NPC and nuclear lamina.
2014-04-03 | GSE56436 | GEO
Project description:Genome wide RNAi screen for regulators of mRNAs silenced in African trypanosome slender forms and expressed in stumpy forms
| PRJNA322510 | ENA
Project description:Different strains of T. brucei induce different degrees of pathology in infected animals, and TREU927-infected mice display greater splenomegaly and anaemia than 247-infected mice. The analysis of differential host gene expression in infected spleens has allowed the identification of which pathways or processes are crucial in determining the progression of disease, for example IL10, LXR/RXR activation and alternative macrophage activation. We used microarray analysis to examine host gene expression between uninfected and infected mice, and between mice infected with the two trypanosome strains.
2009-07-11 | GSE17049 | GEO
Project description:Different strains of T. brucei induce different degrees of pathology in infected animals, and TREU927-infected mice display greater splenomegaly and anaemia than 247-infected mice. The analysis of differential host gene expression in infected spleens has allowed the identification of which pathways or processes are crucial in determining the progression of disease, for example IL10, LXR/RXR activation and alternative macrophage activation. We used microarray analysis to examine host gene expression between uninfected and infected mice, and between mice infected with the two trypanosome strains. Mouse spleens were dissected from infected or uninfected mice 10 days post infection, when the differences in pathology criteria (hepatomegaly, red blood cell numbers, reticulocyte percentage, IL10, IFNg and Il12 levels, and splenomegaly) were the greatest. This allowed a three-way comparison, uninfected vs 247-infected, uninfected vs 927-infected, and 247-infected vs 927-infected, allowing us to analyse genes that are differentially expressed between infected and uninfected spleens, but also crucially allows the differentiation between host gene expression with pathogenic (927) and less pathogenic (247) trypanosome strains.
2010-03-03 | E-GEOD-17049 | biostudies-arrayexpress
Project description:Trypanosome RNA polymerase II transcription is polycistronic, individual mRNAs being excised by trans splicing and polyadenylation. In this study, we refined the previously published mathematical model for bloodstream form parasites and extended it to the procyclic form. We used the model, together with known mRNA half-lives, to predict the abundances of individual mRNAs, assuming rapid, unregulated mRNA processing; then we compared the results with measured mRNA abundances. Remarkably, the abundances of most mRNAs in procyclic forms are predicted quite well by the model, being largely explained by variations in mRNA decay rates and length. In bloodstream forms substantially more mRNAs are less abundant than predicted. We list mRNAs that are likely to show particularly slow or inefficient processing, either in both forms or with developmental regulation. We also measured ribosome occupancies of all mRNAs in trypanosomes grown in the same conditions as were used to measure mRNA turnover. In procyclic forms there was a weak positive correlation between ribosome density and mRNA half-life, suggesting cross-talk between translation and mRNA decay; ribosome density was related to the proportion of the mRNA on polysomes, indicating control of translation initiation. Ribosomal protein mRNAs in procyclics appeared to be exceptionally rapidly processed but poorly translated. Through this study, we conclude that lLevels of mRNAs in procyclic form trypanosomes are determined mainly by length and mRNA decay, with some control of precursor processing. In bloodstream forms variations in nuclear events play a larger role in transcriptome regulation, suggesting acquisition of new control mechanisms during adaptation to mammalian parasitism.
2016-03-16 | GSE79208 | GEO
Project description:Transmission of Trypanosoma brucei by tsetse flies involves the deposition of the infective quiescent metacyclic stage into the mammalian skin at the site of the fly’s bite. In the skin, the metacyclic parasites reactivate and differentiate into proliferative trypanosomes before colonizing the host's blood and tissues. We have generated an advanced human skin equivalent and used tsetse flies to naturally infect the artificial skin with trypanosomes. We have detailed the chronological order of the parasites' development in the skin and found a rapid activation and differentiation of the tsetse-transmitted cell cycle‑arrested metacyclic trypanosomes to proliferative parasites. Single-parasite transcriptomics documented the biological events during differentiation and host invasion at five different time points. After the establishment of a proliferative trypanosome population in the skin, the parasites entered a reversible quiescence program characterized by slow replication and a strongly reduced metabolism. We termed these quiescent trypanosomes skin tissue forms (STF), which may play an important role in maintaining the trypanosome infection in aparasitemic, asymptomatic individuals.
2021-05-30 | GSE174198 | GEO
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress
Project description:Sequencing of progeny from a Trypanosome brucei genetic crosses between T. brucei 927 and T. brucei 927
| PRJEB2012 | ENA
Project description:Sequencing of progeny from a Trypanosome brucei genetic crosses between T. brucei 247 and T. brucei 927
| PRJEB2011 | ENA