Mus musculus
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA318459 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Active and inactive enhancers co-operate to exert localized and long-range control of gene regulation
| PRJNA318456 | ENA
Project description:Active and inactive enhancers co-operate to exert localized and long-range control of gene regulation [ChIP-seq]
| PRJNA318460 | ENA
Project description:Active and inactive enhancers co-operate to exert localized and long-range control of gene regulation [RNA-seq]
| PRJNA318457 | ENA
Project description:Active and inactive enhancers co-operate to exert localized and long-range control of gene regulation [ATAC-seq]
| PRJNA318458 | ENA
Project description:3D-topology of DNA in the cell nucleus provides a level of transcription regulation beyond the sequence of the linear DNA. To study the relationship between transcriptional activity and spatial environment of a gene, we have used allele-specific 4C-technology to produce high-resolution topology maps of the active and inactive X-chromosomes in female cells. We found that loci on the active X form multiple long-range interactions, with spatial segregation of active and inactive chromatin. On the inactive X, silenced loci lack preferred interactions, suggesting a unique random organization inside the inactive territory. However, escapees, among which is Xist, are engaged in long-range contacts with each other, enabling identification of novel escapees. Deletion of Xist results in partial re-folding of the inactive X into a conformation resembling the active X, without affecting gene silencing or DNA methylation. Our data point to a role for Xist RNA in shaping the conformation of the inactive X-chromosome independently of transcription. Five or six 4C viewpoints were applied on the mouse female wild type active X-chromosome, the wild type inactive X-chromosome, the conditional Xist X-chromosome and the Xist knock out X-chromosome
2011-06-24 | E-GEOD-29509 | biostudies-arrayexpress
Project description:The spatial organization of DNA in the cell nucleus is an emerging key contributor to genomic function. We have developed 4C technology, or 3C-on-chip, which allows for an unbiased genome-wide search for DNA loci that contact a given locus in the nuclear space. We demonstrate here that active and inactive genes are engaged in many long-range intrachromosomal interactions and can also form interchromosomal contacts. The active b-globin locus in fetal liver contacts mostly transcribed, but not necessarily tissue-specific, loci elsewhere on chromosome 7, while the inactive locus in fetal brain contacts different, transcriptionally silent, loci. A housekeeping gene in a gene dense region on chromosome 8 forms long-range contacts predominantly with other active gene clusters, both in cis and in trans, and many of these intra- and interchromosomal interactions are conserved between the tissues analyzed. Our data demonstrate that chromosomes fold into areas of active chromatin and areas of inactive chromatin and establish 4C technology as a powerful tool to study nuclear architecture. Keywords: 4C technology
2006-09-22 | GSE5891 | GEO
Project description:3D-topology of DNA in the cell nucleus provides a level of transcription regulation beyond the sequence of the linear DNA. To study the relationship between transcriptional activity and spatial environment of a gene, we have used allele-specific 4C-technology to produce high-resolution topology maps of the active and inactive X-chromosomes in female cells. We found that loci on the active X form multiple long-range interactions, with spatial segregation of active and inactive chromatin. On the inactive X, silenced loci lack preferred interactions, suggesting a unique random organization inside the inactive territory. However, escapees, among which is Xist, are engaged in long-range contacts with each other, enabling identification of novel escapees. Deletion of Xist results in partial re-folding of the inactive X into a conformation resembling the active X, without affecting gene silencing or DNA methylation. Our data point to a role for Xist RNA in shaping the conformation of the inactive X-chromosome independently of transcription.
2011-06-24 | GSE29509 | GEO
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.
2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress
Project description:The impact of signal dependent transcription factors, such as glucocorticoid receptor (GR) and NFκB on the three-dimensional organization of chromatin remains a topic of discussion. The possible scenarios range from remodeling of higher order chromatin architecture by activated transcription factors to recruitment of activated transcription factors to pre-established long-range interactions. Using 4C-seq and high-resolution ChIA-PET analysis of P300 we observed agonist-induced changes in long-range chromatin interactions, and uncovered interconnected enhancer-enhancer hubs spanning up to one megabase. The vast majority of activated GR and NFκB appears to join pre-existing P300 enhancer hubs without affecting the chromatin conformation. In contrast, binding of the activated transcription factors to loci with their consensus response elements leads to increased formation of an active epigenetic state of enhancers and a significant increase in long-range interactions within pre-existing enhancer networks. De novo enhancers or ligand-responsive enhancer hubs preferentially interact with ligand-induced genes. We demonstrate that, at a subset of genomic loci, ligand-mediated induction leads to active enhancer formation and an increase in long-range interactions, facilitating efficient regulation of target genes. Therefore, our data suggest an active role of signal dependent transcription factors in chromatin and long-range interaction remodeling.
2015-09-30 | GSE61911 | GEO
Project description:Recent epigenomic studies have predicted thousands of potential enhancers in the human genome. However, there has not been systematic characterization of target promoters for these potential enhancers. Using H3K4me2 as a mark for active enhancers, we identified genome-wide enhancer-promoter interactions in human CD4+ T cells. Among the 6,520 long-distance chromatin interactions, we identify 2,067 enhancers that interact with 1,619 promoters and enhance their expression. These enhancers exist in accessible chromatin regions and are associated with various histone modifications and Pol II binding. The promoters with interacting enhancers are expressed at higher levels than those without interacting enhancers and their expression levels are positively correlated with the number of interacting enhancers. Interestingly, interacting promoters are co-expressed in a tissue-specific manner. We also find that chromosomes are organized into multiple levels of interacting domains. Our results define a global view of enhancer-promoter interactions and provide a dataset to further understand mechanisms of enhancer targeting and long-range chromatin organization. Two biological replicates of ChIA-PET (Chromatin Interaction Analysis by Paired-End Tag Sequencing) experiment in CD4+ T cells
2012-01-24 | E-GEOD-32677 | biostudies-arrayexpress