<HashMap><database>biostudies-arrayexpress</database><scores/><additional><submitter>Jernej Ule</submitter><organism>Homo sapiens</organism><full_dataset_link>https://www.ebi.ac.uk/biostudies/studies/E-MTAB-13329</full_dataset_link><description>These experiments use a barcoded pool of reporter transcripts, each of which encode the same mScarlet-PPIG_LCD fusion protein, but using different degrees of GA-multivalency via codon bias, and containing a different number of constitutive introns. The reporter pool was expressed either via plasmid transfection or from a dox-incudible promoter. Cells were then fractionated to obtain nuclear and cytoplasmic RNA, and the barcode sequences were amplified to determine the abundance of each different reporter transcript in each fraction. Experiments were performed in triplicate and the nuclear and cytoplasmic fractions for all replicates were multiplexed into one file, which is provided here. Different expression times were sampled to determine how nuclear/cytoplasmic localisation changed in response to changes in PPIG-LCD protein accumulation. In one instance, the effect of the CLK inhibitor CLK-IN-T3 was tested.   Multiple experimental conditions are provided:  Experiment 1: transfection for 16 hours. Experiment 2: transfection for either 8 or 24 hours. Experiment 3: dox-induction for either 4, 8, or 12 hours. Note: expression kinetics are faster with dox induction than transfection. Experiment 4: dox-induction for 6 hours, either with 1 uM CLK-IN-T3 treatment, or with equivalent volume DMSO. Treatment began 2 hours before dox-induction.  Each correct read in each sample should contain the following sequences in the following order:  UMIs (N) and experimental barcodes (B): NNNNNBBBBNNNNN A fixed sequence: GGCCTGCGGATCC A unique plasmid barcode, which identifies the reporter transcript: NNNNNNNNNNNNNNNNNNNN A fixed sequence: GTTGTCGATCGAGACGTAAT Illumina adapter sequences.  The experimental barcode arrangement for each sample is provided as a supplement to this accession.</description><repository>biostudies-arrayexpress</repository><sample_protocol>Nucleic Acid Extraction - RNA extractions were performed from cell pellets using the Maxwell RSC simplyRNA kit (Promega) using a Maxwell RSC Instrument (Promega).</sample_protocol><sample_protocol>Sample Collection - Samples were collected by trypsinising, spinning down, washing in PBS, spinning down and snap freezing on dry ice.</sample_protocol><sample_protocol>Sample Treatment - Cells were either transfected, dox-induced, and sometimes drug treated for the period of time described in the accession description and sample names.</sample_protocol><sample_protocol>Sequencing - Libraries were sequenced on a NovaSeq 6000 by the Advanced Sequencing Facility at The Francis Crick Institute.</sample_protocol><sample_protocol>Library Construction - Superscript IV RT using a barcoded RT primer specific to the reporter transcript. Specific amplification of the barcoded sequences using nested PCR. Final library amplification using indexed i5/i7 Illumina primers.</sample_protocol><sample_protocol>Growth Protocol - Cells were grown in DMEM+Glutamax+10% FBS and seeded such that they achieved 70% confluency on the morning of the experiment, with each sample being derived from 2 wells of a 6 well plate.</sample_protocol><figure_sub>Organization</figure_sub><figure_sub>MINSEQE Score</figure_sub><figure_sub>Assays and Data</figure_sub><figure_sub>Processed Data</figure_sub><figure_sub>MAGE-TAB Files</figure_sub><data_protocol>Data Transformation - The data was not normalised, except by library size (number of reads containing the fixed sequences that flank the unique plasmid barcode).</data_protocol><data_protocol>Sequence Alignment - Reads were aligned using fuzzy string matching of the fixed sequences in the read.</data_protocol><omics_type>Metabolomics</omics_type><omics_type>Unknown</omics_type><omics_type>Transcriptomics</omics_type><omics_type>Genomics</omics_type><omics_type>Proteomics</omics_type><instrument_platform>Maxwell RSC Instrument</instrument_platform><instrument_platform>Illumina NovaSeq 6000</instrument_platform><study_type>RNA-seq of coding RNA</study_type><species>Homo sapiens</species><pubmed_authors>Rupert Faraway</pubmed_authors><pubmed_authors>Jernej Ule</pubmed_authors></additional><is_claimable>false</is_claimable><name>Targeted sequencing of reporter transcripts with variable GA-multivalency and intron content</name><description>These experiments use a barcoded pool of reporter transcripts, each of which encode the same mScarlet-PPIG_LCD fusion protein, but using different degrees of GA-multivalency via codon bias, and containing a different number of constitutive introns. The reporter pool was expressed either via plasmid transfection or from a dox-incudible promoter. Cells were then fractionated to obtain nuclear and cytoplasmic RNA, and the barcode sequences were amplified to determine the abundance of each different reporter transcript in each fraction. Experiments were performed in triplicate and the nuclear and cytoplasmic fractions for all replicates were multiplexed into one file, which is provided here. Different expression times were sampled to determine how nuclear/cytoplasmic localisation changed in response to changes in PPIG-LCD protein accumulation. In one instance, the effect of the CLK inhibitor CLK-IN-T3 was tested.   Multiple experimental conditions are provided:  Experiment 1: transfection for 16 hours. Experiment 2: transfection for either 8 or 24 hours. Experiment 3: dox-induction for either 4, 8, or 12 hours. Note: expression kinetics are faster with dox induction than transfection. Experiment 4: dox-induction for 6 hours, either with 1 uM CLK-IN-T3 treatment, or with equivalent volume DMSO. Treatment began 2 hours before dox-induction.  Each correct read in each sample should contain the following sequences in the following order:  UMIs (N) and experimental barcodes (B): NNNNNBBBBNNNNN A fixed sequence: GGCCTGCGGATCC A unique plasmid barcode, which identifies the reporter transcript: NNNNNNNNNNNNNNNNNNNN A fixed sequence: GTTGTCGATCGAGACGTAAT Illumina adapter sequences.  The experimental barcode arrangement for each sample is provided as a supplement to this accession.</description><dates><release>2025-07-29T00:00:00Z</release><modification>2025-07-30T00:01:38.784Z</modification><creation>2023-09-04T15:58:30.568Z</creation></dates><accession>E-MTAB-13329</accession><cross_references><ENA>ERP150953</ENA><EFO>EFO_0002944</EFO><EFO>EFO_0004170</EFO><EFO>EFO_0003789</EFO><EFO>EFO_0004917</EFO><EFO>EFO_0005518</EFO><EFO>EFO_0003816</EFO><EFO>EFO_0003738</EFO><EFO>EFO_0004184</EFO><EFO>EFO_0003969</EFO></cross_references></HashMap>