biostudies-arrayexpressMus musculushttps://www.ebi.ac.uk/biostudies/studies/E-MTAB-13738Transactive response DNA binding protein of 43 kDa (TDP43) is a ribonucleoprotein integral to several neurodegenerative diseases. Under normal conditions, TDP43 primarily localizes in the nucleus, where it plays a crucial role in RNA metabolism. Its function necessitates shuttling between the nucleus and cytoplasm. TDP43 dysfunction plays a significant role in the pathogenesis of neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), Alzheimer's disease (AD), and Parkinson’s disease. A common dysfunction of TDP43 is nuclear depletion and cytoplasmic aggregation of the protein. Additionally, aggregation-prone mutations, such as the TDP43M337V mutation, exacerbate TDP43 mislocalization to the cytoplasm, increasing neuronal toxicity. Given TDP43's critical role in RNA processing, its depletion or mutation disrupts the transcriptomic landscape, leading to aberrant RNA processing and splicing. In this study, we employed a library preparation method capturing both coding and noncoding RNA, generating a comprehensive nuclear transcriptomic dataset following TDP43 knockdown or mutant TDP43M337V expression in NSC34 motor neurons. This nuanced strategy significantly enhances our understanding of the intricate interplay between TDP43 dysfunction and the cellular transcriptome, providing valuable insights into the pathogenesis of TDP43 proteinopathies.biostudies-arrayexpressLibrary Construction - The RNA samples, encompassing those derived from RNAi investigations and TDP43 mutation experiments, were prepared for sequencing following the RNA extraction procedure. Samples achieving RNA Integrity Number (RIN) values of 8.5 or higher, as determined through bioanalyzer analysis, were selected for further analysis. Library construction was carried out using the SEQuoia Complete Stranded RNA Library Prep Kit (Bio-Rad: 17005710), specifically designed for comprehensive capture of both long and short RNA molecules. This kit enables a thorough depiction of the coding and noncoding transcriptome within a single library. Following library preparation, ribodepletion was performed using the SEQuoia RiboDepletion Kit (Bio-Rad: 17006487).Sample Treatment - For TDP43 knockdown in NSC34 motor neurons and other cell lines, Lipofectamine™ RNAiMAX Transfection Reagent was utilized to transfect cells with two TDP43-specific siRNAs: Mm_Tardp 1 siRNA and Mm_Tardp 2 siRNA. These siRNAs targeted the TDP43 gene with sequences AACGATGAACCCATTGAAATA and CAGTAACATGGTAACATTAAA, respectively. Non-silencing Qiagen AllStars Negative Control siRNA and AllStars Mm/Rn Cell Death Control siRNA served as controls for non-specific effects and cell viability. Cells were seeded 24 hours prior to transfection, reaching 45-60% confluency in various plate formats. On the day of transfection, a siRNA-lipid complex was formed by combining Lipofectamine RNAiMAX Reagent and siRNA diluted in Opti-MEM Medium. The complex was added to fresh antibiotic-free media, resulting in a final siRNA concentration of 20nM. Cells were incubated for 6 hours, media changed, and further incubated for up to 24 hours following which RNA was extracted for downstream analysis. For the TDP43 mutant expression experiment, the coding sequences of wild-type TDP43 and mutant TDP43M337V were synthesized and inserted into the Express Cloning Vector pcDNA3.1+C-eGFP to generate the Cloning vectors: TDP43_WTT_pcDNA3.1(+)-C-eGFP plasmid (Genescript: SC1691) and TDP43_MVT_pcDNA3.1(+)-C-eGFP (Genescript: SC1693), denoted as WTT (Wild type TDP) and MVT (mutant TDP43) respectively. Upon synthesis and validation, WTT and MVT plasmids were introduced into E. coli and cultivated overnight on plates. Three individual colonies for each plasmid were chosen, cultured in LB media supplemented with ampicillin, and subjected to mini-prep extraction using the Zyppy™ Plasmid Miniprep Kit (Zymo Research: D4036). The isolated plasmids were evaluated for DNA concentration and purity using a Nanodrop Spectrophotometer, followed by analysis using long-read Sanger sequencing. Sequencing outcomes were aligned with the original sequences using SnapGene for authentication. Confirmed colonies were utilized to generate maxi-preps, ensuring elevated concentrations of the plasmid vector containing the intended DNA sequences. For transfection, NSC34 cells were seeded to 60% confluency in 6-well plates and subsequently transfected with WTT (control, n=8) and WTT (mutant TDP43, n=8) employing Lipofectamine™ 3000 Transfection Reagent (Invitrogen: L3000001) diluted in Opti-MEM. Plasmid DNA along with P300 reagents were also diluted in Opti-MEM. The diluted DNA and transfection reagent were combined and added to fresh media. Following incubation under standard conditions for up to 48 hours, RNA was extracted for downstream analysis.Sequencing - Sequencing was conducted as single-end 1x75 bp reads on the NovaSeq 6000 platform (Illumina, San Diego, USA) to generate approximately 50 million reads per library. The sequencing phase occurred at the Institute of Experimental Biology, Marceli Nencki Polish Academy of Sciences. The normalization process was executed using DESeq2. Specifically, the DESeq function was employed, utilizing the median-of-ratios method. In this approach, DESeq2 normalizes the raw counts by dividing each count by a size factor. The size factor for each sample is calculated as the median of the ratio of its raw counts to the geometric mean of counts across all samples. Following normalization, the acquired data underwent quality control, alignment, and identification of differentially expressed genes or transcripts.Sample Collection - For RNA extraction, the initial step involved the removal of cell culture media, followed by a single wash of cells with ice-cold PBS. Subsequently, 1 ml of Trizol per sample was added after complete removal of PBS, and the cells were subjected to shaking for 5 minutes at room temperature on a rotary shaker at 300 RPM.Nucleic Acid Extraction - The resulting cell lysate underwent vigorous pipetting and vortexing. The homogenized sample was then incubated for 5 minutes at room temperature to facilitate the complete dissociation of nucleoprotein complexes. In the next step, 0.2 ml of chloroform per 1 ml of Trizol reagent was added, vigorously vortexed until the lysate became visibly white, and incubated at room temperature for 2 to 3 minutes. Following centrifugation at 12,000g for 15 minutes at 2-8°C, the upper aqueous phase was carefully transferred to a fresh tube without disturbing the interphase. A volume of 400 µl of the aqueous phase was collected, and an equal volume of chloroform was added. After another centrifugation at 12,000g for 15 minutes at 2-8°C, 0.5 ml of isopropyl alcohol was added to the samples, mixed, and incubated at room temperature for 10 minutes. To enhance visibility, 10 µl of glycogen was introduced. Subsequently, the samples were centrifuged at 12,000g for 10 minutes at 2-4°C. Following removal of the supernatant, the RNA pellet underwent two washes with 1 ml of 70% ethanol, accompanied by vortexing and centrifugation at 7,500g for 5 minutes. The pellet was air-dried for 30 minutes, and the RNA was resuspended in 30 µl of DEPC-treated water. The quantification of RNA was carried out using a Nanodrop Spectrophotometer.Growth Protocol - The NSC34 motor neuron cell line, initially at passage 3 (p3), was obtained from Tebubio, with a primary focus on these cells. All cells, including NSC34, were cultured and sustained in complete media (CM) in a T75 flask, and subculturing was performed upon reaching 80-90% confluency. The complete media (CM) consisted of Dulbecco's Modified Eagle's Medium (DMEM Sigma-Aldrich: D5796) containing 4500 mg/L glucose, L-glutamine, and sodium bicarbonate, excluding sodium pyruvate. This liquid medium was sterile-filtered and enriched with 10% Fetal Bovine Serum (FBS, Gibco: 10500064) and 1% Penicillin-Streptomycin (Gibco: 15140122) to support cell maintenance and growth.The subculturing process involved rinsing cells with Dulbecco's Phosphate-Buffered Saline (DPBS, Gibco: 14190-144) and dissociating them using TrypLE™ Express Enzyme (Gibco: 12604013). Subsequently, the dissociated cells were harvested, centrifuged at room temperature at 120 revolutions per minute (rpm) for 5 minutes, the supernatant was discarded, and the cells were reconstituted with complete DMEM medium. These reconstituted cells were then maintained under the aforementioned culture conditions.MINSEQE ScoreAssays and DataProcessed DataorganisationMAGE-TAB FilesData Transformation - In DESeq2, we utilized the DESeq function to conduct normalization through the median-of-ratios method. Specifically, this normalization technique involves dividing the raw counts by a size factor. The size factor for each sample is determined by calculating the median of the ratio between its raw counts and the geometric mean of counts across all samples. Importantly, this method is chosen to effectively address variations in sequencing depth between samples.MetabolomicsUnknownTranscriptomicsGenomicsProteomicsIllumina NovaSeq 6000RNA-seq of total RNAMus musculusERP156983Ismail GbadamosiAli JawaidRamiro MagnoSandra BiniasIsabel DuarteBartłomiej GielniewskifalseComprehensive Transcriptomic Analysis of NSC34 Motor Neurons following TDP43 Modulation: Knockdown vs. Control and Wild Type vs. TDP43 M337V MutationTransactive response DNA binding protein of 43 kDa (TDP43) is a ribonucleoprotein integral to several neurodegenerative diseases. Under normal conditions, TDP43 primarily localizes in the nucleus, where it plays a crucial role in RNA metabolism. Its function necessitates shuttling between the nucleus and cytoplasm. TDP43 dysfunction plays a significant role in the pathogenesis of neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), Alzheimer's disease (AD), and Parkinson’s disease. A common dysfunction of TDP43 is nuclear depletion and cytoplasmic aggregation of the protein. Additionally, aggregation-prone mutations, such as the TDP43M337V mutation, exacerbate TDP43 mislocalization to the cytoplasm, increasing neuronal toxicity. Given TDP43's critical role in RNA processing, its depletion or mutation disrupts the transcriptomic landscape, leading to aberrant RNA processing and splicing. In this study, we employed a library preparation method capturing both coding and noncoding RNA, generating a comprehensive nuclear transcriptomic dataset following TDP43 knockdown or mutant TDP43M337V expression in NSC34 motor neurons. This nuanced strategy significantly enhances our understanding of the intricate interplay between TDP43 dysfunction and the cellular transcriptome, providing valuable insights into the pathogenesis of TDP43 proteinopathies.2025-06-04T00:00:00Z2025-06-04T17:40:38.574Z2024-01-29T13:03:10.731ZE-MTAB-13738ERP156983EFO_0002944EFO_0004170EFO_0009653EFO_0003789EFO_0005518EFO_0003816EFO_0004184EFO_0003969