{"database":"biostudies-arrayexpress","file_versions":[],"scores":null,"additional":{"submitter":[null],"organism":["Mus musculus"],"full_dataset_link":["https://www.ebi.ac.uk/biostudies/studies/E-MTAB-13870"],"description":["Increased or decreased B16 cell sensitivity to activated cytotoxic T lymphocytes.To identify tumor cell-intrinsic genes essential for antigen-specific CD8+ T cell killing, we utilized the B16.SIY melanoma cell line which expressed the model antigen SIY (SIYRYYGL) co-expressed with DsRed, that can be recognized by 2C CD8+ TCR transgenic (Tg) T cells.  B16.SIY cells were transduced and selected to stably expressed a Cas9 gene, and then transduced with a genome-scale CRISPR gRNA library.Transduced cells were cultured for 8 days to provide time for gene disruption to occur, then were co-cultured with pre-activated 2C CD8+ T cells at a 2:1 Effector:Target ratio for 16 hours. By performing deep sequencing, we examined the sgRNA library representation in tumor cells with or without T cell co-incubation by MAGeCK analysis."],"repository":["biostudies-arrayexpress"],"sample_protocol":["Sequencing - Libraries were sequenced on a illumina. 3 sequencing primers were used: : Multiplexing Read 1 Sequencing Primer, Multiplexing Index Read Sequencing Primer, Multiplexing Read 2 Sequencing Primer.","Sample Collection - To identify tumor cell-intrinsic genes essential for antigen-specific CD8+ T cell killing, we utilized the B16.SIY melanoma cell line which expressed the model antigen SIY (SIYRYYGL) co-expressed with DsRed, that can be recognized by 2C CD8+ TCR transgenic (Tg) T cells.  B16.SIY cells were transduced and selected to stably expressed a Cas9 gene, and then transduced with a genome-scale CRISPR gRNA library.  The library consists of 87,897 sgRNA sequences targeting 19,150 mouse protein-coding genes.  Transduced cells were cultured for 8 days to provide time for gene disruption to occur, then were co-cultured with pre-activated 2C CD8+ T cells at a 2:1 Effector:Target ratio for 16 hours, which we had previously shown results in around 99% killing of WT B16.SIY cells 27.  By performing deep sequencing, we examined the sgRNA library representation in tumor cells with or without T cell co-incubation by MAGeCK analysis","Nucleic Acid Extraction - The genomic DNA was extracted by MasterPure Complete DNA and RNA Purification Kit Cat No. MC85200 from LGC Biosearch Technologies","Library Construction - two-step PCR amplification were performed on gDNA using  Q5® High-Fidelity DNA Polymerases (Neb). The first PCR step (PCR1) included amplification of the region containing sgRNA cassette using gRNA F1 (CTTGAAAGTATTTCGATTTC) and gRNA R (ACTCGGTGCCACTTTTTCAAGT) primers, and the second step PCR (PCR2) included amplification using uniquely Illumina barcoded adaptor-containing primers to allow multiplexing of samples in a single MiSeq.","Sample Treatment - Transduced cells were cultured for 8 days to provide time for gene disruption to occur, then were co-cultured with pre-activated 2C CD8+ T cells at a 2:1 Effector:Target ratio for 16 hours, which we had previously shown results in around 99% killing of WT B16.SIY cells"],"figure_sub":["MINSEQE Score","Assays and Data","Processed Data","organisation","MAGE-TAB Files"],"data_protocol":["Data Transformation - The sequencing results were analyzed by MAGeCK :  One-sided test for enrichment or depletion of the sgRNAs and sgRNA rank aggregation was performed for each gene using MAGeCK (model-based analysis of genome-wide CRISPR–Cas9 knockout), with default parameter settings38. On the basis of MAGeCK output, a gene was considered to exhibit a significant enrichment/depletion of its sgRNAs if P ≤ 0.05, enriched (or depleted)."],"omics_type":["Metabolomics","Unknown","Transcriptomics","Genomics","Proteomics"],"instrument_platform":["Illumina NovaSeq 6000"],"study_type":["DNA-seq"],"species":["Mus musculus"],"additional_accession":["ERP160337"],"pubmed_authors":["Shuyin Li"]},"is_claimable":false,"name":"Tumor cell-intrinsic Decr2 regulates ferroptosis and immunotherapy efficacy","description":"Increased or decreased B16 cell sensitivity to activated cytotoxic T lymphocytes.To identify tumor cell-intrinsic genes essential for antigen-specific CD8+ T cell killing, we utilized the B16.SIY melanoma cell line which expressed the model antigen SIY (SIYRYYGL) co-expressed with DsRed, that can be recognized by 2C CD8+ TCR transgenic (Tg) T cells.  B16.SIY cells were transduced and selected to stably expressed a Cas9 gene, and then transduced with a genome-scale CRISPR gRNA library.Transduced cells were cultured for 8 days to provide time for gene disruption to occur, then were co-cultured with pre-activated 2C CD8+ T cells at a 2:1 Effector:Target ratio for 16 hours. By performing deep sequencing, we examined the sgRNA library representation in tumor cells with or without T cell co-incubation by MAGeCK analysis.","dates":{"release":"2025-06-30T00:00:00Z","modification":"2025-03-24T13:19:21.837Z","creation":"2024-02-28T19:50:12.244Z"},"accession":"E-MTAB-13870","cross_references":{"ENA":["ERP160337"],"EFO":["EFO_0002944","EFO_0004170","EFO_0002693","EFO_0005518","EFO_0003816","EFO_0004184","EFO_0003969"]}}