biostudies-arrayexpressMus musculushttps://www.ebi.ac.uk/biostudies/studies/E-MTAB-13870Increased or decreased B16 cell sensitivity to activated cytotoxic T lymphocytes.To identify tumor cell-intrinsic genes essential for antigen-specific CD8+ T cell killing, we utilized the B16.SIY melanoma cell line which expressed the model antigen SIY (SIYRYYGL) co-expressed with DsRed, that can be recognized by 2C CD8+ TCR transgenic (Tg) T cells. B16.SIY cells were transduced and selected to stably expressed a Cas9 gene, and then transduced with a genome-scale CRISPR gRNA library.Transduced cells were cultured for 8 days to provide time for gene disruption to occur, then were co-cultured with pre-activated 2C CD8+ T cells at a 2:1 Effector:Target ratio for 16 hours. By performing deep sequencing, we examined the sgRNA library representation in tumor cells with or without T cell co-incubation by MAGeCK analysis.biostudies-arrayexpressSequencing - Libraries were sequenced on a illumina. 3 sequencing primers were used: : Multiplexing Read 1 Sequencing Primer, Multiplexing Index Read Sequencing Primer, Multiplexing Read 2 Sequencing Primer.Sample Collection - To identify tumor cell-intrinsic genes essential for antigen-specific CD8+ T cell killing, we utilized the B16.SIY melanoma cell line which expressed the model antigen SIY (SIYRYYGL) co-expressed with DsRed, that can be recognized by 2C CD8+ TCR transgenic (Tg) T cells. B16.SIY cells were transduced and selected to stably expressed a Cas9 gene, and then transduced with a genome-scale CRISPR gRNA library. The library consists of 87,897 sgRNA sequences targeting 19,150 mouse protein-coding genes. Transduced cells were cultured for 8 days to provide time for gene disruption to occur, then were co-cultured with pre-activated 2C CD8+ T cells at a 2:1 Effector:Target ratio for 16 hours, which we had previously shown results in around 99% killing of WT B16.SIY cells 27. By performing deep sequencing, we examined the sgRNA library representation in tumor cells with or without T cell co-incubation by MAGeCK analysisNucleic Acid Extraction - The genomic DNA was extracted by MasterPure Complete DNA and RNA Purification Kit Cat No. MC85200 from LGC Biosearch TechnologiesLibrary Construction - two-step PCR amplification were performed on gDNA using Q5® High-Fidelity DNA Polymerases (Neb). The first PCR step (PCR1) included amplification of the region containing sgRNA cassette using gRNA F1 (CTTGAAAGTATTTCGATTTC) and gRNA R (ACTCGGTGCCACTTTTTCAAGT) primers, and the second step PCR (PCR2) included amplification using uniquely Illumina barcoded adaptor-containing primers to allow multiplexing of samples in a single MiSeq.Sample Treatment - Transduced cells were cultured for 8 days to provide time for gene disruption to occur, then were co-cultured with pre-activated 2C CD8+ T cells at a 2:1 Effector:Target ratio for 16 hours, which we had previously shown results in around 99% killing of WT B16.SIY cellsMINSEQE ScoreAssays and DataProcessed DataorganisationMAGE-TAB FilesData Transformation - The sequencing results were analyzed by MAGeCK : One-sided test for enrichment or depletion of the sgRNAs and sgRNA rank aggregation was performed for each gene using MAGeCK (model-based analysis of genome-wide CRISPR–Cas9 knockout), with default parameter settings38. On the basis of MAGeCK output, a gene was considered to exhibit a significant enrichment/depletion of its sgRNAs if P ≤ 0.05, enriched (or depleted).MetabolomicsUnknownTranscriptomicsGenomicsProteomicsIllumina NovaSeq 6000DNA-seqMus musculusERP160337Shuyin LifalseTumor cell-intrinsic Decr2 regulates ferroptosis and immunotherapy efficacyIncreased or decreased B16 cell sensitivity to activated cytotoxic T lymphocytes.To identify tumor cell-intrinsic genes essential for antigen-specific CD8+ T cell killing, we utilized the B16.SIY melanoma cell line which expressed the model antigen SIY (SIYRYYGL) co-expressed with DsRed, that can be recognized by 2C CD8+ TCR transgenic (Tg) T cells. B16.SIY cells were transduced and selected to stably expressed a Cas9 gene, and then transduced with a genome-scale CRISPR gRNA library.Transduced cells were cultured for 8 days to provide time for gene disruption to occur, then were co-cultured with pre-activated 2C CD8+ T cells at a 2:1 Effector:Target ratio for 16 hours. By performing deep sequencing, we examined the sgRNA library representation in tumor cells with or without T cell co-incubation by MAGeCK analysis.2025-06-30T00:00:00Z2025-03-24T13:19:21.837Z2024-02-28T19:50:12.244ZE-MTAB-13870ERP160337EFO_0002944EFO_0004170EFO_0002693EFO_0005518EFO_0003816EFO_0004184EFO_0003969