<HashMap><database>biostudies-arrayexpress</database><scores/><additional><submitter>Baptiste Alberti</submitter><organism>Drosophila melanogaster</organism><full_dataset_link>https://www.ebi.ac.uk/biostudies/studies/E-MTAB-14445</full_dataset_link><description>Targeted PCR amplification and sequencing of a reporter construct from a nos-phiC31; attP40 line of Drosophila stage 6 embryos. Flies carried two copies of one of 25 different enhancer reporter assays. The region amplified by PCR contains the enhancer and 10X cell barcodes required for analysis. Three samples were generated from the three cDNAs generated during the 10X 3'end scRNA-seq experiment. The complementary scRNA-seq datasets are available here:</description><repository>biostudies-arrayexpress</repository><sample_protocol>Sample Collection - Freshly hatched adults from the pool of transgenic flies containing our library of candidate enhancers were combined in 5 embryo collection vials with standard apple cap plates. After three 45-minute pre-lays, Drosophila embryos were collected on apple juice plates for one-hour collection and incubated for another 2.5 hours at 25°C. We verified that the collected embryos mostly span developmental stages 5 to 7. The embryos were dechorionated using 2,6% bleach for 2 minutes, washed with water and PBS + 0.1% Triton X-100, finally resuspended in 1 ml of ice-cold PBS + 0.1% Triton X-100 and kept on ice. Embryos were washed with ice-cold PBS, resuspended in 10 mL of dissociation buffer (PBS 1X + 0.1% BSA) and dissociated on ice in a Dounce homogenizer with gentle strokes of the loose pestle. This process was repeated for all collected embryos, using a small number of embryos each time. The cell suspension was transferred to 15 mL Falcon tubes and centrifuged for 10 minutes at 40g at 4°C to pellet debris. Cells in the supernatant were transferred to new Falcon tubes and centrifuged again for 10 minutes at 800g at 4°C. The supernatant was discarded, and cell pellets were combined and resuspended in 0.5 mL of dissociation buffer. Two additional rounds of centrifugations, each for 5 minutes at 800g at 4°C were performed to remove as much debris as possible. Cells were counted using a Malassez counting chamber and the concentration was adjusted to 900 cells/µl in the dissociation buffer. Single cells were encapsulated into droplets in the Chromium Controller instrument for cell lysis and barcoded reverse transcription of mRNA. 40 µl of cDNA were recovered, and 10 µl (25%) were used for amplification, fragmentation, and Illumina library construction.</sample_protocol><sample_protocol>Sequencing - Libraries were sequenced on a NovaSeq sequencer (Illumina) using 150-bp paired-end reads, yielding 10 million reads per sample.</sample_protocol><sample_protocol>Nucleic Acid Extraction - Cells were encapsulated with the 10X chromium device. RNA extraction was performed by the Chromium Controller during the encapsulation.</sample_protocol><sample_protocol>Library Construction - From the remaining 30µl of cDNA generated during the scRNA-seq library preparation, 300 ng were used for targeted PCR amplification. The region containing the specific enhancer barcode and the 10X Genomics barcodes (cellular barcode and UMI) was amplified with the Q5 Hot Start High Fidelity polymerase (New England Biolabs). The forward primer binds to the 19nt sequence common to all constructs (GACGTCATCGTCCTGCAGG) and the reverse primer to the TruSeqRead1 sequence added during the scRNA-seq library preparation (CTACACGACGCTCTTCCGATC). The cycling conditions were as follows:  Initial denaturation at 98°C for 10 seconds; then 25 cycles at 98°C for 10 seconds, 68°C for 30 seconds, 72°C for 20 seconds; then an elongation step at 72°C for 5 min. The PCR product was purified using SPRIselect beads (Beckman Coulter) and 100 ng used to generate the final libraries using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). The libraries were indexed for multiplexing using NEBNext multiplex oligos kit for Illumina (New England Biolabs)</sample_protocol><figure_sub>Organization</figure_sub><figure_sub>MINSEQE Score</figure_sub><figure_sub>Assays and Data</figure_sub><figure_sub>Processed Data</figure_sub><figure_sub>MAGE-TAB Files</figure_sub><data_protocol>Data Transformation - Cutadapt (v4.5) [http://dx.doi.org/10.14806/ej.17.1.200] was used to trim PCR-specific reads with a three-step script. Each step applied two trimming parameters: a minimal overlap of 10 nucleotides (-O 10) and removal of both reads if either did not meet criteria (--pair-filter=any). Cutadapt allows a default error rate of 1 in 10 nucleotides. Step one involved removing the 19bp common sequence (GACGTCatcgtcctgcagg) from forward reads and the 10X adaptor sequence (CTACACGACGCTCTTCCGATCT) from reverse reads. For the second step, both sequences were also checked on the opposite strand. All reads passing any of these two steps were merged into one forward (R1) and one reverse (R2) file. The final trimming removed the second common sequence (GCTGCCGCTTCGAGCAGACATGCATATG) and everything downstream, ensuring R1 reads contained only the 6-nucleotide enhancer barcode, while R2 reads retained only the first 28 nucleotides with the 10X cell+UMI barcodes.   In the specific case where the 10X adaptor sequence had been removed by Illumina’s trimming software, we used seqkit (v2.6.1) [https://doi.org/10.1371/journal.pone.0163962] to scan for 20 thymines within the 29th to 60th nucleotides, which is the region where the polyT sequence can be found if the adaptor was absent. For every reverse read in this case, if the forward read had the common sequence trimmed beforehand (GACGTCatcgtcctgcagg), the pair of reads was kept and sent back to the last trimming step.</data_protocol><omics_type>Metabolomics</omics_type><omics_type>Unknown</omics_type><omics_type>Transcriptomics</omics_type><omics_type>Genomics</omics_type><omics_type>Proteomics</omics_type><instrument_platform>Illumina NovaSeq X</instrument_platform><study_type>RNA-seq of coding RNA</study_type><species>Drosophila melanogaster</species><pubmed_title>Integrating Single-Cell RNA Sequencing with Spatial Reconstruction to predict enhancer activity in early Drosophila development</pubmed_title><pubmed_authors>Baptiste Alberti</pubmed_authors><pubmed_authors>Yad Ghavi-Helm</pubmed_authors><pubmed_authors>B. Alberti, S. Vincent, I. Stévant, D.Lajoignie, P. Villoutreix, Y. Ghavi-Helm</pubmed_authors></additional><is_claimable>false</is_claimable><name>Targeted PCR amplification and sequencing of reporter constructs from stage 6 drosophila embryos</name><description>Targeted PCR amplification and sequencing of a reporter construct from a nos-phiC31; attP40 line of Drosophila stage 6 embryos. Flies carried two copies of one of 25 different enhancer reporter assays. The region amplified by PCR contains the enhancer and 10X cell barcodes required for analysis. Three samples were generated from the three cDNAs generated during the 10X 3'end scRNA-seq experiment. The complementary scRNA-seq datasets are available here:</description><dates><release>2025-07-14T00:00:00Z</release><modification>2025-07-10T14:01:21.872Z</modification><creation>2024-09-11T15:37:56.607Z</creation></dates><accession>E-MTAB-14445</accession><cross_references><ENA>ERP164041</ENA><Biostudies>E-MTAB-14447</Biostudies><EFO>EFO_0002944</EFO><EFO>EFO_0004170</EFO><EFO>EFO_0005518</EFO><EFO>EFO_0003816</EFO><EFO>EFO_0003738</EFO><EFO>EFO_0004184</EFO></cross_references></HashMap>