{"database":"biostudies-arrayexpress","file_versions":[],"scores":null,"additional":{"submitter":["Tajda Klobučar"],"organism":["Mus musculus"],"software":["nf-core/clipseq v1.0.0 (https://nf-co.re/clipseq/1.0.0/)"],"full_dataset_link":["https://www.ebi.ac.uk/biostudies/studies/E-MTAB-14763"],"description":["Global iCLIP was performed on UV-crosslinked mouse naive embryonic pluripotent stem cells (nPSCs) and primed pluripotent stem cells (pPSCs) (150 mJ/cm² at 254 nm) using the iiCLIP protocol (https://doi.org/10.1101/2021.08.27.457890 ), omitting the immunoprecipitation step to capture all crosslinking events."],"repository":["biostudies-arrayexpress"],"sample_protocol":["Sequencing - Libraries were sequenced as paired-end 150 bp reads on NovaSeq at Clinical Institute of Special Laboratory Diagnostics, University Children's Hospital at Ljubljana University Medical Centre. Due to library construction only Read 1 was used for analysis.","Library Construction - iCLIP was performed according to the iiCLIP protocol (https://doi.org/10.1101/2021.08.27.457890 ), using UV crosslinked cell lysate (nPSCs G9, p17 and pPSCs G9, p20) containing 1.5 mg of total protein mass per sample. Three replicates (10 cm plate each) were prepared for each cell state (naive and primed). Briefly, cell pellet was lysed and sonicated (Bioruptor) before treatment with RNase I to accurately digest the RNA. Then, the 3' ends were dephosphorylated and 3' adapter ligation (IR labeled) was performed. The samples were then loaded on SDS-PAGE and transferred to nitrocellulose membrane to be able to extract all protein-RNA complexes above 40kDa. RNA was extracted from the membrane using proteinase K digestion, followed by phenol:chloroform extraction. Upon RNA precipitation, the whole material was used for reverse transcription using RT primers and SSIV reverse transcriptase. Upon cDNA cleanup, it was circularised overnight and then PCR amplified using P5/P7 Illumina-compatible primers.","Nucleic Acid Extraction - iCLIP was performed according to the iiCLIP protocol (https://doi.org/10.1101/2021.08.27.457890), using UV crosslinked cell lysate (nPSCs G9, p17 and pPSCs G9, p20) containing 1.5 mg of total protein mass per sample. Three replicates (10 cm plate each) were prepared for each cell state (naive - nPSCs and primed-pPSCs). See nucleic acid library construction protocol for full details.","Sample Collection - Confluent 10 cm plate (per replicate) was washed with ice-cold PBS and irradiated once with 150 mJ/cm^2 in a Crosslinker CL-3000 at 254nm (AnalytikJena). Cells were kept on ice throughout the crosslinking process and were harvested using cell lifters (734-1526, Corning), centrifuged at 1200 rpm for 3 min, then the supernatant was removed and the cell pellet frozen at -80°C until use.","Growth Protocol - Naive mESCs (nPSCs) were maintained in 2i media (PMID: 18497825), fed every day and split every 2-3 days using Accutase (A6964, Sigma). Primed pPSC were obtained previously from naive state and maintained in primed medium (N2B27 basal medium with ActA 20 ng/ml, bFGF 12 ng/mL, IWP2 2 µM) on cell culture dishes (TPP) coated with Geltrex (A1413302, Gibco), fed every day and split every 2-3 days using Accutase (A6964, Sigma)."],"figure_sub":["Organization","MINSEQE Score","Assays and Data","Processed Data","MAGE-TAB Files"],"data_protocol":["Data Transformation - The crosslink BED files were automatically generated by nf-core/clipseq v1.0.0.","Sequence Alignment - The deposited raw FASTQ files include UMIs stored in the read headers. Reads were analysed using nf-core/clipseq v1.0.0 with default settings, except for specifying the 3’ adapter sequence (--adapter AGATCGGAAGAGCACACGTCTG) and the UMI separator (--umi_separator 'rbc:') for deduplication. Reads were aligned to the mouse reference genome (GRCm39, GENCODE release M27)."],"omics_type":["Metabolomics","Unknown","Transcriptomics","Genomics","Proteomics"],"instrument_platform":["Illumina NovaSeq 6000"],"study_type":["CLIP-seq"],"species":["Mus musculus"],"pubmed_authors":["Tajda Klobučar","Ira Iosub","Miha Modic"],"additional_accession":[]},"is_claimable":false,"name":"Global iCLIP in naive and primed mouse embryonic stem cells to analyse RNA-binding protein occupancy on RNA","description":"Global iCLIP was performed on UV-crosslinked mouse naive embryonic pluripotent stem cells (nPSCs) and primed pluripotent stem cells (pPSCs) (150 mJ/cm² at 254 nm) using the iiCLIP protocol (https://doi.org/10.1101/2021.08.27.457890 ), omitting the immunoprecipitation step to capture all crosslinking events.","dates":{"release":"2025-09-16T00:00:00Z","modification":"2025-09-16T01:02:19.444Z","creation":"2025-01-20T22:25:16.78Z"},"accession":"E-MTAB-14763","cross_references":{"ENA":["ERP168501"],"EFO":["EFO_0002944","EFO_0004170","EFO_0003789","EFO_0003143","EFO_0004917","EFO_0005518","EFO_0003816","EFO_0004184"]}}