{"database":"biostudies-arrayexpress","file_versions":[],"scores":null,"additional":{"submitter":["Anna-Leigh Brown"],"organism":["Mus musculus"],"full_dataset_link":["https://www.ebi.ac.uk/biostudies/studies/E-MTAB-15282"],"description":["Targeted primers for Taf1 transcript across different brain regions (cerebellum, cortex, hippocampus, striatum) and different mouse body regions (heart muscle spleen) in male and female. Long read sequencing performed on cDNA with nanopore sequencing."],"repository":["biostudies-arrayexpress"],"sample_protocol":["Nucleic Acid Extraction - The final extracted RNA was eluted in DNase- and RNase-free water. RNA was quantified using a NanoDrop spectrophotometer followed by RNA Integrity Analysis. cDNA synthesis was carried out using Superscript™ IV First-Strand Synthesis System (11904-018; Thermo Fisher Scientific). 2 μg RNA was used as input for annealing of oligo-dT primers. Final clean-up was performed with 1 μL of RNase H.","Sequencing - Nanopore sequencing libraries were prepared using the ligation sequencing kit (SQK-LSK109) and barcoded individually using the Native Barcoding Kit 96 V14 (SQK-NBD114.96). 200 fmol of purified amplicon DNA was subjected to an end-prep reaction using the NEBNext Ultra II End Repair/dA-tailing Module (New England BioLabs, MA). End-prepped amplicons were taken forward to the native barcode ligation step; a total of 2.5 μL of amplicons was mixed with 1.25 μL of native barcode, 5.75 μL of blunt/TA ligase master mix, and 0.5 μL H2O and then incubated at room temperature for 20 min and at 65°C for 10 min. A batch of X barcoded amplicons was pooled, and a 0.5x AMPure XP bead (Beckman Coulter, CA) purification was carried out with two subsequent 500 μL 80% ethanol washes. The barcoded library was eluted in 30 μL nuclease-free water and quantified in the Qubit 1× double-stranded DNA (dsDNA) high-sensitivity assay kit (Invitrogen, OR) with a Qubit 4 fluorometer (Invitrogen). The barcoded library was subjected to ligation of the sequencing adapter; 10 μL of 5× NEBNext quick ligation reaction buffer, 5 μL of ONT Adapter Mix II (AMII), and 5 μL of Quick T4 DNA ligase were mixed with 30 μL of the barcoded library and then incubated at room temperature for 20 min. The library was purified by 1× AMPure XP bead with two subsequent 250-μL short fragment buffer (SFB) washes and eluted in 15 μL of EB buffer (ONT). The final library was quantified with the Qubit 1× dsDNA high-sensitivity assay kit (Invitrogen) and a Qubit 4 fluorometer (Invitrogen). Approximately 60 ng of the final library was loaded onto the FLO-MIN106D (R9.4.1) flow cell on an Oxford Nanopore MinION MK 1C platform for 10 h.","Sample Collection - Total RNA was extracted from 3-month mouse brain from four distinct brain regions: cerebellum, cortex, hippocampus and striatum (Supplementary Table S1) using the RNeasy Mini Kit (Qiagen). Total RNA was extracted from 3-month mouse spleen, heart and quadricep muscle (Supplementary Table S1) using the RNeasy Fibrous Tissue Mini Kit (Qiagen). All tissue was homogenised on ice using a TissueRuptor II (QIAGEN) in Buffer RLT with 1% β-mercaptoethanol, following the manufacturer’s instructions for both kits.","Library Construction - RT-PCR was performed using LongAmp® Taq DNA Polymerase (New England Biolabs). Optimal annealing temperature was determined using a gradient thermocycler. Primers were designed and screened for specificity using NCBI's Primer-BLAST. The primers were positioned to anneal to conserved, non-coding regions flanking the longest common sequence, allowing for the amplification of all Taf1 mRNA variants, from the 5' untranslated region (UTR) (Forward primer sequence: AAGTCACCCGTGTGCGACTGACG) through to the 3' UTR (Reverse primer sequence: AGCTGGGGGGAAAGGTAATAGACC). For each sample, duplicate PCRs were performed in reaction volumes of 50 μL with 0.1 mM of each primer. Thermocycling conditions were an initial denaturation step at 94 °C for 30 seconds, followed by 29 cycles of 94 °C for 30 seconds for denaturation, 61 °C for 30 seconds for    annealing, and 65 °C for 12 minutes for extension. This was followed by a final extension at 65 °C for 10 minutes, and the reactions were held at 4 °C indefinitely. The number of cycles was optimized at 29 to ensure adequate amplification of the target sequences while minimizing non-specific products. Following amplification, the duplicate samples were pooled and the size of the RT-PCR product verified by agarose gel electrophoresis in 1x TAE buffer using SYBR Safe DNA stain for visualisation. The remaining PCR product (~80 μL) was sent to Full Circle Laboratories and purified using 0.5x AMPure XP beads (Beckman Coulter, Fullerton, USA) before proceeding to library construction."],"figure_sub":["Organization","MINSEQE Score","Assays and Data","Processed Data","MAGE-TAB Files"],"data_protocol":["Data Transformation - data were quantified to the canonical and novel (Isoquant determined isoforms) Taf1 transcriptome using oarfish"],"omics_type":["Unknown","Transcriptomics","Genomics","Proteomics"],"instrument_platform":["MinION"],"study_type":["RNA-seq of coding RNA"],"species":["Mus musculus"],"pubmed_authors":["Anna-Leigh Brown"],"additional_accession":[]},"is_claimable":false,"name":"Taf1 isoform expression in mouse","description":"Targeted primers for Taf1 transcript across different brain regions (cerebellum, cortex, hippocampus, striatum) and different mouse body regions (heart muscle spleen) in male and female. Long read sequencing performed on cDNA with nanopore sequencing.","dates":{"release":"2025-12-05T00:00:00Z","modification":"2025-12-05T02:02:38.97Z","creation":"2025-06-26T22:50:13.451Z"},"accession":"E-MTAB-15282","cross_references":{"ENA":["ERP174131"],"EFO":["EFO_0002944","EFO_0004170","EFO_0005518","EFO_0003816","EFO_0003738","EFO_0004184"]}}