{"database":"biostudies-arrayexpress","file_versions":[],"scores":null,"additional":{"submitter":["Barbara Sixt"],"organism":["Homo sapiens"],"full_dataset_link":["https://www.ebi.ac.uk/biostudies/studies/E-MTAB-15337"],"description":["Chlamydia trachomatis is a prevalent bacterial cause of urogenital and ocular infections. The pathogen uses the effector CpoS to suppress a host defense response that aborts intracellular bacterial growth by inducing host cell death. We conducted a CRISPR knockout screen to identify host genes contributing to this response, thereby revealing modulators of C. trachomatis parasitophorous vacuole stability.  In brief, we transduced HeLa cells, a human cervical epithelial cell line, with a genome-wide knockout library. More specifically, we used the Brunello sgRNA library (which targets 19,114 genes and comprises a total of 77,441 sgRNAs, including about four sgRNAs per gene and 1000 non-targeting control sgRNAs). An aliquot of the transduced cells was collected to determine the composition of the pre-selection cell population (= sample “Pre”). In the selection procedure, we infected transduced cells with C. trachomatis L2/434/Bu, either wildtype (CTL2) or a strain carrying an insertional disruption of cpoS (CTL2-cpoS::cat). Later, we collected cells resistant to infection-mediated killing, that is, cells resistant to late-stage lytic death in the case of CTL2 or premature death in the case of CTL2-cpoS::cat. Hence, we included four distinct conditions: uninfected cells and cells infected with CTL2-cpoS::cat collected at 30 hours post infection (samples “UI30h” and “KO30h”), and uninfected cells and cells infected with CTL2 collected at 60 hours post infection (samples “UI60h” and “WT60h”). The screen was performed in two independent replicates (R1+R2)."],"repository":["biostudies-arrayexpress"],"sample_protocol":["Sample Collection - We transduced HeLa cells, a human cervical epithelial cell line, with the Brunello sgRNA library (which targets 19,114 genes and comprises a total of 77,441 sgRNAs, including about four sgRNAs per gene and 1000 non-targeting control sgRNAs). An aliquot of the transduced cells was collected to determine the composition of the pre-selection cell population (= sample “Pre”). In the selection procedure, we infected transduced cells with C. trachomatis L2/434/Bu, either wildtype (CTL2) or a strain carrying an insertional disruption of cpoS (CTL2-cpoS::cat). Later, we collected cells resistant to infection-mediated killing, that is, cells resistant to late-stage lytic death in the case of CTL2 or premature death in the case of CTL2-cpoS::cat. Hence, we included four distinct conditions: uninfected cells and cells infected with CTL2-cpoS::cat collected at 30 hours post infection (samples “UI30h” and “KO30h”), and uninfected cells and cells infected with CTL2 collected at 60 hours post infection (samples “UI60h” and “WT60h”).  For cell collection, the cells were washed twice with Dulbecco's phosphate-buffered saline (DPBS) in the flasks (to remove dead cells and cell debris), harvested, counted, washed once more with DPBS, pelleted (800 x g, 10 min), and stored at -80°C.","Library Construction - Guide and unique molecular identifier (UMI) sequences were amplified by PCR using modified primers PCR2_FW (5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTTGTGGAAAGGACGAAACAC-3’) and PCR3_fw (5’-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACG CTCT-3’), respectively.","Sequencing - The amplicon was sequenced on Illumina NovaSeq, reading 20 cycles Read 1 with custom primer 5’-CGATCTCTTGTGGAAAGGACGAAACACCG-3’, 10 cycles index read i7 to read the random sequence label (RSL), and six cycles index read i5 to read the sample barcode. The sequencing data were analyzed using the MAGeCK software (v.0.5.6).","Nucleic Acid Extraction - Genomic DNA was isolated from all cell pellets using the QIAamp DNA Blood Maxi Kit (Qiagen). Prior to following the manufacturer’s instructions, RNase A (800 µg/10 million cells) was added to all samples. DNA was quantified using Qubit dsDNA BR Assay Kit (Thermo-Fisher-Scientific)."],"figure_sub":["Organization","MINSEQE Score","Assays and Data","MAGE-TAB Files"],"omics_type":["Metabolomics","Unknown","Transcriptomics","Genomics","Proteomics"],"instrument_platform":["Illumina NovaSeq X"],"study_type":["DNA-seq"],"species":["Homo sapiens"],"pubmed_title":["Genome-wide identification of modulators of Chlamydia trachomatis parasitophorous vacuole stability highlights an important role for sphingolipid supply"],"pubmed_authors":["Mohammed Rizwan Babu Sait, Lana H. Jachmann, Gözde Türköz, Milica Milivojevic, Celia Llorente-Sáez, Soniya Dhanjal, Fabian Schumacher, Sara Henriksson, Naga Venkata Gayathri Vegesna, Noha Seddik, Anastasiia Chaban, Partha Mohanty, Magnus Ölander, Samada Muraleedharan, Sepideh Farmand Azadeh, Burkhard Kleuser, Bernhard Schmierer, Barbara S. Sixt","Barbara Sixt"],"additional_accession":[]},"is_claimable":false,"name":"A CRISPR knockout screen revealed modulators of Chlamydia trachomatis parasitophorous vacuole stability","description":"Chlamydia trachomatis is a prevalent bacterial cause of urogenital and ocular infections. The pathogen uses the effector CpoS to suppress a host defense response that aborts intracellular bacterial growth by inducing host cell death. We conducted a CRISPR knockout screen to identify host genes contributing to this response, thereby revealing modulators of C. trachomatis parasitophorous vacuole stability.  In brief, we transduced HeLa cells, a human cervical epithelial cell line, with a genome-wide knockout library. More specifically, we used the Brunello sgRNA library (which targets 19,114 genes and comprises a total of 77,441 sgRNAs, including about four sgRNAs per gene and 1000 non-targeting control sgRNAs). An aliquot of the transduced cells was collected to determine the composition of the pre-selection cell population (= sample “Pre”). In the selection procedure, we infected transduced cells with C. trachomatis L2/434/Bu, either wildtype (CTL2) or a strain carrying an insertional disruption of cpoS (CTL2-cpoS::cat). Later, we collected cells resistant to infection-mediated killing, that is, cells resistant to late-stage lytic death in the case of CTL2 or premature death in the case of CTL2-cpoS::cat. Hence, we included four distinct conditions: uninfected cells and cells infected with CTL2-cpoS::cat collected at 30 hours post infection (samples “UI30h” and “KO30h”), and uninfected cells and cells infected with CTL2 collected at 60 hours post infection (samples “UI60h” and “WT60h”). The screen was performed in two independent replicates (R1+R2).","dates":{"release":"2025-07-10T00:00:00Z","modification":"2025-07-09T17:17:16.443Z","creation":"2025-07-09T15:40:30.627Z"},"accession":"E-MTAB-15337","cross_references":{"ENA":["ERP175140"],"EFO":["EFO_0002944","EFO_0004170","EFO_0002693","EFO_0005518","EFO_0004184"]}}