{"database":"biostudies-arrayexpress","file_versions":[],"scores":null,"additional":{"submitter":["Leo Zeef"],"organism":["Homo sapiens"],"software":["Bcl2fastq v2.20.0.422"],"full_dataset_link":["https://www.ebi.ac.uk/biostudies/studies/E-MTAB-15392"],"description":["Notochord-derived cells (NCs) in the developing nucleus pulposus (NP) maintain its hydrated extracellular matrix, essential for the shock-absorbing function of the intervertebral disc (IVD). The aging-associated loss of NCs initiates IVD degeneration, contributing to back pain. Despite their critical role in IVD homeostasis, little is known about human NCs. To identify key regulators and inform regenerative therapies, we characterised the proteomic profile of human fetal NCs, identifying Ellis-van Creveld (EVC) syndrome protein as the top enriched protein in the NC population.  EVC was expressed in fetal, paediatric, and adult human NP, localising to the primary cilium of NP cells. Its expression positively correlated with Hedgehog (Hh) signalling activity. Using Evc knockout mouse models and CRISPR-engineered human EVC knockout NP cells, we demonstrate that EVC enhanced Sonic hedgehog (Shh) signalling in NP cells, played a vital role in maintaining NP cell phenotype, and regulated extracellular matrix composition. Evc knockout mice exhibited delayed embryonic vertebral body ossification. Both Shh activation and EVC expression helped mitigate NP fibrosis. In contrast, TGF-β signalling downregulated EVC expression and altered Gli3 processing.  This study identifies EVC as a regulator of IVD formation and maintenance, uncovering molecular mechanisms by which downregulation of Shh signalling leads to disc degeneration. EVC emerges as a mediator of Shh and TGF-β crosstalk in NP cells. As such, EVC may be a promising target for strategies aimed at preventing or reversing disc degeneration and promoting tissue regeneration."],"repository":["biostudies-arrayexpress"],"sample_protocol":["Nucleic Acid Extraction - RNA samples from WT and EVC-/- human NP cells with or without SAG treatment (n=4) were prepared using TRIzol.","Sample Collection - A previously described human NP cell line (NP-nR105, PMID: 24972717)  was cultured in DMEM high glucose (Sigma-Aldrich A5796) with 10% fetal bovine serum (Gibco A5256701), 100 units/mL antibiotic antimycotic solution (Sigma-Aldrich A5955), 10 µM ascorbate-2-phosphate (Sigma-Aldrich A8960), and 100 nM sodium pyruvate (Sigma-Aldrich S8636) at 37°C under 5% CO2. Human NP EVC knockout (EVC-/-) cells were generated using CRISPR/Cas9 targeting EVC exon 4 with an sgRNA (TGTCATCGCTGGTGGCCGAG TGG) designed in-house and synthesized by Integrated DNA Technologies (IDT). The sgRNA was delivered via electroporation (1400V, 20ms, 2 pulses). Monoclonal lines were isolated by serial dilution and expanded. Knockout validation was confirmed using Sanger sequencing, IF, and Western blot analysis. To activate the Hedgehog pathway, WT and EVC-/- cells at approximately 80% confluence were switched to 0.5% FBS medium supplemented with 1µM Smoothened agonist (SAG, Calbiochem 56661) for 40 hours. RNA samples from WT and EVC-/- human NP cells with or without SAG treatment (n=4) were prepared using TRIzol.","Sequencing - Paired end sequencing","Library Construction - Illumina stranded mRNA library"],"figure_sub":["Organization","MINSEQE Score","Assays and Data","Processed Data","MAGE-TAB Files"],"data_protocol":["Sequence Alignment - The reads were mapped against the reference human genome (hg38) and counts per gene were calculated using annotation from GENCODE 43 (http://www.gencodegenes.org/) using STAR_2.7.7a (PMID: 23104886).","Data Transformation - Normalisation was done with DESeq2 v1.40.2"],"omics_type":["Unknown","Transcriptomics","Genomics","Proteomics"],"instrument_platform":["Illumina NovaSeq 6000"],"study_type":["RNA-seq of coding RNA"],"species":["Homo sapiens"],"pubmed_authors":["Leo Zeef"],"additional_accession":[]},"is_claimable":false,"name":"EVC protein regulates sonic hedgehog signalling during human intervertebral disc development and degeneration","description":"Notochord-derived cells (NCs) in the developing nucleus pulposus (NP) maintain its hydrated extracellular matrix, essential for the shock-absorbing function of the intervertebral disc (IVD). The aging-associated loss of NCs initiates IVD degeneration, contributing to back pain. Despite their critical role in IVD homeostasis, little is known about human NCs. To identify key regulators and inform regenerative therapies, we characterised the proteomic profile of human fetal NCs, identifying Ellis-van Creveld (EVC) syndrome protein as the top enriched protein in the NC population.  EVC was expressed in fetal, paediatric, and adult human NP, localising to the primary cilium of NP cells. Its expression positively correlated with Hedgehog (Hh) signalling activity. Using Evc knockout mouse models and CRISPR-engineered human EVC knockout NP cells, we demonstrate that EVC enhanced Sonic hedgehog (Shh) signalling in NP cells, played a vital role in maintaining NP cell phenotype, and regulated extracellular matrix composition. Evc knockout mice exhibited delayed embryonic vertebral body ossification. Both Shh activation and EVC expression helped mitigate NP fibrosis. In contrast, TGF-β signalling downregulated EVC expression and altered Gli3 processing.  This study identifies EVC as a regulator of IVD formation and maintenance, uncovering molecular mechanisms by which downregulation of Shh signalling leads to disc degeneration. EVC emerges as a mediator of Shh and TGF-β crosstalk in NP cells. As such, EVC may be a promising target for strategies aimed at preventing or reversing disc degeneration and promoting tissue regeneration.","dates":{"release":"2025-12-08T00:00:00Z","modification":"2025-12-08T15:48:57.086Z","creation":"2025-07-24T13:23:08.018Z"},"accession":"E-MTAB-15392","cross_references":{"ENA":["ERP177210"],"EFO":["EFO_0002944","EFO_0004170","EFO_0004917","EFO_0005518","EFO_0003816","EFO_0003738","EFO_0004184"]}}