{"database":"biostudies-arrayexpress","file_versions":[],"scores":null,"additional":{"submitter":["Anna-Leigh Brown"],"organism":["Homo sapiens"],"full_dataset_link":["https://www.ebi.ac.uk/biostudies/studies/E-MTAB-15433"],"description":["Nuclear depletion and cytoplasmic aggregation of the RNA-binding protein TDP-43 is the hallmark of ALS, occurring in over 97% of cases. A key consequence of TDP-43 nuclear loss is the de-repression of cryptic exons. Motor neurons are the vulnerable cell-type in ALS and cryptic exons show variability in expression by cell-type. A human induced pluripotent stem cell (iPSC) line (WTC11), stably expressing a doxycycline-inducible hNIL construct and CRISPR/Cas9 was used in this study. Differentiation of human iPSCs was performed as previously reported. Briefly, iPSC induction was achieved using induction medium containing DMEM/F12, GlutaMAX supplement medium (Thermo Fisher), MEM non-essential amino acids (Thermo Fisher), N2 supplement (Thermo Fisher), 0.2 mM compound E, 2 μg/ml doxycycline, Pen/Strep and 10 μM Y-27632. After induction for 48 h, cells were dissociated from plates by Accutase and reseeded on poly-D-lysine (PDL)/laminin-coated tissue culture dishes or microfluidic devices in induction medium supplemented with 1 μg/ml laminin. After 24 h, induction medium was replaced by motor neuron medium containing Neurobasal (Thermo Fisher), B27 Plus supplement (Thermo Fisher), N2 supplement, Culture One supplement (Thermo Fisher), 1 μg/ml laminin, 2 μg/ml doxycycline, and Pen/Strep. Medium change was performed every 1-3 days. To achieve knockdown, sgRNAs targeting TARDBP (GGGAAGTCAGCCGTGAGACC) were delivered to iPS cells by lentiviral transduction."],"repository":["biostudies-arrayexpress"],"sample_protocol":["Sample Collection - The human induced pluripotent stem cells used are the WTC11 line, stably expressing a doxycycline-inducible hNIL construct and CRISPR/cas9. Briefly, iPSCs were seeded on tissue culture dishes coated with 120-180 μg/ml Geltrex (Thermo Fisher). Cells were maintained in iPSC medium containing Essential 8 Flex Medium (E8F, Thermo Fisher), E8 Flex supplement (Thermo Fisher), and 100 U/ml Pen/Strep and maintained in a 37 ºC, 5% CO2 incubator. Medium change was performed every 1-2 days. Passage of cells were performed with Stem Pro Accutase (Thermo Fisher) for 1-2 min at 37 ºC. Accutase was removed by centrifugation at 300 g for 5 min, and the cells were reseeded in iPS cell media supplemented with 10 μM ROCK inhibitor (Y-27632, Selleckchem) to facilitate survival. ROCK inhibitor was removed after 24 h.","Nucleic Acid Extraction - Cells were washed with PBS and RNA was extracted using the Qiagen RNeasy isolation and purification kit.","Library Construction - Sequencing libraries were prepared using the KAPA HyperPrep Kit with RiboErase kit (Roche).","Sequencing - Samples were sequenced at 2 x 150 base pairs on an Illumina NextSeq 2000 machine."],"figure_sub":["Organization","MINSEQE Score","Assays and Data","Processed Data","MAGE-TAB Files"],"data_protocol":["Sequence Alignment - Samples were aligned to the Genome Reference Consortium Human Build 38 (GRCh38) using STAR using v 2.7.4","Data Transformation - For gene expression counts reads were pseudo-aligned to gencode_v42 with salmon version 1.4.0"],"omics_type":["Metabolomics","Unknown","Transcriptomics","Genomics","Proteomics"],"instrument_platform":["NA","NextSeq 2000"],"study_type":["RNA-seq of coding RNA"],"species":["Homo sapiens"],"pubmed_authors":["Anna-Leigh Brown"],"additional_accession":[]},"is_claimable":false,"name":"RNA-seq in WTC11 i3 lower-motor neurons with and without TDP-43 knockdown","description":"Nuclear depletion and cytoplasmic aggregation of the RNA-binding protein TDP-43 is the hallmark of ALS, occurring in over 97% of cases. A key consequence of TDP-43 nuclear loss is the de-repression of cryptic exons. Motor neurons are the vulnerable cell-type in ALS and cryptic exons show variability in expression by cell-type. A human induced pluripotent stem cell (iPSC) line (WTC11), stably expressing a doxycycline-inducible hNIL construct and CRISPR/Cas9 was used in this study. Differentiation of human iPSCs was performed as previously reported. Briefly, iPSC induction was achieved using induction medium containing DMEM/F12, GlutaMAX supplement medium (Thermo Fisher), MEM non-essential amino acids (Thermo Fisher), N2 supplement (Thermo Fisher), 0.2 mM compound E, 2 μg/ml doxycycline, Pen/Strep and 10 μM Y-27632. After induction for 48 h, cells were dissociated from plates by Accutase and reseeded on poly-D-lysine (PDL)/laminin-coated tissue culture dishes or microfluidic devices in induction medium supplemented with 1 μg/ml laminin. After 24 h, induction medium was replaced by motor neuron medium containing Neurobasal (Thermo Fisher), B27 Plus supplement (Thermo Fisher), N2 supplement, Culture One supplement (Thermo Fisher), 1 μg/ml laminin, 2 μg/ml doxycycline, and Pen/Strep. Medium change was performed every 1-3 days. To achieve knockdown, sgRNAs targeting TARDBP (GGGAAGTCAGCCGTGAGACC) were delivered to iPS cells by lentiviral transduction.","dates":{"release":"2026-07-04T00:00:00Z","modification":"2026-07-04T01:00:56.034Z","creation":"2025-08-01T12:13:40.938Z"},"accession":"E-MTAB-15433","cross_references":{"ENA":["ERP177703"],"EFO":["EFO_0002944","EFO_0004170","EFO_0004917","EFO_0005518","EFO_0003816","EFO_0003738","EFO_0004184"]}}