biostudies-arrayexpressJosh McQuailEscherichia coli K-12https://www.ebi.ac.uk/biostudies/studies/E-MTAB-15469RNA-seq was carried out to compare the transcriptomes of wild-type MG1655 E coli with mutants lacking the glucose metabolism regulator TmaR , in bacteria that had been exposed to short-term (3hr) and long-term (24hr) nitrogen starvation in Gutnick minimal media. A rifampicin-chase experiment was performed following long-term (24hr) nitrogen starvation, with 150ug/ml rifampicin added at N-24, with samples taken 15 and 60 minutes following treatment. TmaR is required for the formation of Hfq foci, a novel sub-cellular feature that forms during long-term nitrogen starvation. The aim of this work was to use the mutant lacking TmaR to understand the functional role of the Hfq foci, and whether they play a role in sRNA stability during long-term nitrogen starvation.biostudies-arrayexpressGrowth Protocol - Bacteria were grown in Gutnick minimal medium according to (Figueira et al., Sci Rep, 2015), where the sole source of nitrogen is NH4Cl; overnight cultures were grown in medium containing 10 mM NH4Cl and N-limiting growth cultures were carried out in medium containing 3 mM NH4Cl. Cultures were grown as in (Figueira et al., Sci Rep, 2015) and sampled at N-3 & N-24, where bacteria were subjected to 3 & 24 hours of N starvation respectively. Further samples were taken following treatment with rifampicin, as described in treatment protocol. Note that N-24 and T=0 are the same samples.Nucleic Acid Extraction - Pellets were resuspended in RNA extraction solution (18 mM EDTA, 0.025% SDS, 1% 2-mercaptoethanol, 95% formamide) and lysed at 95°C for 10min. Cell debris was pelleted by centrifugated. RNA was purified with PureLink RNA Mini Kit extraction columns (Invitrogen, 12183018A) largely in accordance with the manufacturer’s protocol for Total Transcriptome Isolation except with a final ethanol concentration of 66% to increase the yield of smaller RNA species.Sample Collection - Three biological replicates of each strain/timepoint/time-post-treatment were taken and mixed with a phenol:ethanol (1:19) solution at a ratio of 9:1 (culture:solution) before harvesting the bacteria immediately by centrifugation.Sequencing - Sequencing of pooled libraries, spiked with PhiX control library, was performed at a minimum of 7 million reads per sample in single-ended mode with 100 cycles on the NextSeq 2000 platform (Illumina). Demultiplexed FASTQ files were generated with bcl-convert v4.2.4 (Illumina). Raw sequencing reads were subjected to quality and adapter trimming via Cutadapt (25) v2.5 using a cutoff Phred score of 20 and discarding reads without any remaining bases (parameters: --nextseq-trim=20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC).Library Construction - Ribo-depleted RNA samples were first fragmented using ultrasound (4 pulses of 30 s at 4°C). Then, an oligonucleotide adapter was ligated to the 3' end of the RNA molecules. First-strand cDNA synthesis was performed using M-MLV reverse transcriptase with the 3’ adapter as primer. After purification, the 5' Illumina TruSeq sequencing adapter was ligated to the 3' end of the antisense cDNA. The resulting cDNA was PCR-amplified using a high-fidelity DNA polymerase and the barcoded TruSeq-libraries were pooled in approximately equimolar amounts.Sample Treatment - Cultures from N-24 were treated with 100ug/ml of rifampicin and, samples were taken prior to treatment (T=0), and following 15 & and 60 minutes (T=15 & T=60) of incubation. Note that N-24 and T=0 are the same samples.OrganizationMINSEQE ScoreAssays and DataProcessed DataMAGE-TAB FilesSequence Alignment - All reads longer than 11 nt were aligned to the E. coli K12 MG1655 reference genome (RefSeq assembly accession: GCF_000005845.2) using the pipeline READemption (26) v2.0.3 with segemehl version 0.3.4 (27) and an accuracy cut-off of 95% (parameters: -l 12 -a 95). READemption gene_quanti was applied to quantify aligned reads overlapping genomic features by at least 10 nt (-o 10) on the sense strand based on Genebank annotations (CDS, ncRNA, rRNA, tRNA) for assembly GCF_000005845.2 from Dec 17, 2024.Data Transformation - Normalisation was performed as a part of DESeq2 analysis for comparison of the N-3 and N-24 samples.MetabolomicsUnknownTranscriptomicsGenomicsProteomicsIllumina HiSeq 2000RNA-seq of total RNAEscherichia coli K-12Josh McQuailSivaramesh WigneshwerarajfalseRNA-seq analysis of MG1655 Escherichia coli (Wild-type, and mutants lacking the glucose metabolism regulator TmaR) experiencing short- & long-term N starvation and following treatment with rifampicin during long-term N starvation in Gutnick minimal mediaRNA-seq was carried out to compare the transcriptomes of wild-type MG1655 E coli with mutants lacking the glucose metabolism regulator TmaR , in bacteria that had been exposed to short-term (3hr) and long-term (24hr) nitrogen starvation in Gutnick minimal media. A rifampicin-chase experiment was performed following long-term (24hr) nitrogen starvation, with 150ug/ml rifampicin added at N-24, with samples taken 15 and 60 minutes following treatment. TmaR is required for the formation of Hfq foci, a novel sub-cellular feature that forms during long-term nitrogen starvation. The aim of this work was to use the mutant lacking TmaR to understand the functional role of the Hfq foci, and whether they play a role in sRNA stability during long-term nitrogen starvation.2025-09-23T00:00:00Z2025-09-23T01:04:25.932Z2025-08-08T15:43:48.229ZE-MTAB-15469ERP178573EFO_0002944EFO_0004170EFO_0009653EFO_0003789EFO_0004917EFO_0005518EFO_0003816EFO_0004184EFO_0003969