{"database":"biostudies-arrayexpress","file_versions":[],"scores":null,"additional":{"submitter":["Rita Maravilha Marques"],"organism":["Lathyrus sativus"],"full_dataset_link":["https://www.ebi.ac.uk/biostudies/studies/E-MTAB-15524"],"description":["Seven closely related species from Hologalegina and Phaseoloid clades were selected: Lathyrus sativus, Pisum sativum (Lathyrus oleraceus), Lens culinaris, Cicer arietinum, Medicago truncatula, Glycine max, and Phaseolus vulgaris, to assess tissue-specific expression in non-inoculated conditions. Plants were cultivated in 0.5 L pots containing growth medium (50% soil, 25% vermiculite, 25% peat) in controlled environment chambers at 22°C with a 12/12-hour photoperiod. At the three fully expanded leaf developmental stage, leaf and root tissues were harvested separately, and RNA was extracted. RNA samples were submitted for Illumina NovaSeq 6000 Sequencing PE150 (40 million paired-end reads per sample) at Novogene (UK) Co. Raw reads were trimmed with cutadapt and gene counts were obtained using StringTie with the respective annotation files of each genome."],"repository":["biostudies-arrayexpress"],"sample_protocol":["Growth Protocol - Plants were cultivated in 0.5 L pots containing growth medium (50% soil, 25% vermiculite, 25% peat) in controlled environment chambers at 22°C with a 12/12-hour photoperiod.","Sample Collection - At the three fully expanded leaf developmental stage, leaf and root tissues were harvested separately, immediately frozen in liquid nitrogen, and stored at -80°C until processing.","Library Construction - mRNA library preparation was performed using poly A enrichment.","Nucleic Acid Extraction - Total RNA was extracted from approximately 100 mg of tissue using the GeneJET Plant RNA Purification Mini Kit (Thermo Scientific, Vilnius, Lithuania) according to manufacturer's protocols, with three biological replicates per tissue and species.","Sequencing - RNA samples were submitted for Illumina NovaSeq 6000 Sequencing PE150 (40 million paired-end reads, and 12 G raw data per sample) at Novogene (UK) Co."],"figure_sub":["Organization","MINSEQE Score","Assays and Data","Processed Data","MAGE-TAB Files"],"data_protocol":["Sequence Alignment - raw .fastq files were trimmed for quality, barcodes and Illumina adaptors using the Cutadapt v4.0 command: cutadapt -j 8 -q 20 -u 10 -U 10 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -o tXXXXX_1.fq.gz -p tXXXXX_2.fq.gz XXXXX_1.fq.gz XXXXX_2.fq.gz Trimmed .fq files were aligned to each respective genome using HISAT2 v2.2.1","Data Transformation - Counts were obtained using StringTie with the respective annotation files of each genome. More details can be found in the respective manuscript."],"omics_type":["Unknown","Transcriptomics","Genomics","Proteomics"],"instrument_platform":["Illumina NovaSeq 6000"],"study_type":["RNA-seq of coding RNA"],"species":["Lathyrus sativus"],"pubmed_authors":["Rita Maravilha Marques","Sophien Kamoun","Carmen Santos","Maria Carlota Vaz Patto","Jiorgos Kourelis","Hsuan Pai"],"additional_accession":[]},"is_claimable":false,"name":"RNA-seq of healthy seedling leaf and root tissue of seven legume species","description":"Seven closely related species from Hologalegina and Phaseoloid clades were selected: Lathyrus sativus, Pisum sativum (Lathyrus oleraceus), Lens culinaris, Cicer arietinum, Medicago truncatula, Glycine max, and Phaseolus vulgaris, to assess tissue-specific expression in non-inoculated conditions. Plants were cultivated in 0.5 L pots containing growth medium (50% soil, 25% vermiculite, 25% peat) in controlled environment chambers at 22°C with a 12/12-hour photoperiod. At the three fully expanded leaf developmental stage, leaf and root tissues were harvested separately, and RNA was extracted. RNA samples were submitted for Illumina NovaSeq 6000 Sequencing PE150 (40 million paired-end reads per sample) at Novogene (UK) Co. Raw reads were trimmed with cutadapt and gene counts were obtained using StringTie with the respective annotation files of each genome.","dates":{"release":"2025-11-30T00:00:00Z","modification":"2025-11-30T02:02:32.487Z","creation":"2025-09-02T19:50:53.783Z"},"accession":"E-MTAB-15524","cross_references":{"ENA":["ERP179522"],"EFO":["EFO_0002944","EFO_0004170","EFO_0003789","EFO_0004917","EFO_0005518","EFO_0003816","EFO_0003738","EFO_0004184"]}}