{"database":"biostudies-arrayexpress","file_versions":[],"scores":null,"additional":{"submitter":["Elisa Balmas"],"organism":["Homo sapiens"],"full_dataset_link":["https://www.ebi.ac.uk/biostudies/studies/E-MTAB-15684"],"description":["This dataset was generated to study the role of the DNA-binding factors CTCF and GATA4 in cardiac specification. Three WTC11-derived hiPSC lines were used, each carrying a stably integrated shRNA construct. Two constructs specifically target CTCF and GATA4, while the third expresses a scrambled, non-targeting shRNA as control. All shRNA systems are controlled by a tetracycline-inducible promoter, enabling conditional knockdown.  Each of the three lines was differentiated into a 2D monolayer of cardiomyocytes, both with and without tetracycline treatment, providing an isogenic control for each knockdown. For every condition, two independent differentiations were performed to ensure reproducibility."],"repository":["biostudies-arrayexpress"],"sample_protocol":["Nucleic Acid Extraction - RNA was extracted with the ZymoResearch kit and converted to cDNA.","Sequencing - reads were sequenced with high-output NextSeq, in paired-end mode (75 bp)","Library Construction - Zymo - Seq RiboFree Total RNA Library Prep Kit (R3000S) + the Zymo-See Index Primer Set (D3007). 300 ng were pooled with final concentration of ~6ng/uL. The average size of the library is ~350 bp","Sample Treatment - half of the samples (indicated with TET) were treated with tetracycline 1 ug/ml since the split of hiPSCs immediately before differentiation","Sample Collection - hiPSCs derived cardiomyocytes were differentiated in a monolayer and collected at day 25 of differentiation. Cardiomyocites were directly lysed on the plate and collected."],"figure_sub":["Organization","MINSEQE Score","Assays and Data","Processed Data","MAGE-TAB Files"],"data_protocol":["Sequence Alignment - Reads were trimmed to remove the adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and AGATCGGAAGAGCGTCGTGTAGGGAAAGA and an extra trimming of 1 bp at 3' and 5 at 5' was perfomed to remove artifacts of the library. Trimmed reads were aligned over an indexed reference genome built on the ENSEMBL GRCh38.112 using STAR 2.7.11b in GeneCounts mode","Data Transformation - filtering for reads with at least 3 counts in a minimum of 2 samples, and filtering for protein coding genes using DeSEQ2. Reads were then normalised in TPM usin the ADImpute R package, and the read length file obtained with gtftools (-l function)"],"omics_type":["Metabolomics","Unknown","Transcriptomics","Genomics","Proteomics"],"instrument_platform":["NextSeq 500"],"study_type":["RNA-seq of coding RNA"],"species":["Homo sapiens"],"pubmed_authors":["Sara Bianchi","Elisa Balmas"],"additional_accession":[]},"is_claimable":false,"name":"Bulk RNA sequencing of cardiomyocytes differentiated in monolayer (2D) from hiPSC-derived cell lines with tetracycline-inducible knockdown of CTCF and GATA4","description":"This dataset was generated to study the role of the DNA-binding factors CTCF and GATA4 in cardiac specification. Three WTC11-derived hiPSC lines were used, each carrying a stably integrated shRNA construct. Two constructs specifically target CTCF and GATA4, while the third expresses a scrambled, non-targeting shRNA as control. All shRNA systems are controlled by a tetracycline-inducible promoter, enabling conditional knockdown.  Each of the three lines was differentiated into a 2D monolayer of cardiomyocytes, both with and without tetracycline treatment, providing an isogenic control for each knockdown. For every condition, two independent differentiations were performed to ensure reproducibility.","dates":{"release":"2025-10-14T00:00:00Z","modification":"2026-05-30T16:45:19Z","creation":"2025-10-09T16:03:26.743Z"},"accession":"E-MTAB-15684","cross_references":{"ENA":["ERP181285"],"EFO":["EFO_0002944","EFO_0004170","EFO_0004917","EFO_0005518","EFO_0003816","EFO_0003738","EFO_0004184","EFO_0003969"]}}