{"database":"biostudies-arrayexpress","file_versions":[],"scores":null,"additional":{"submitter":["Rene Ketting"],"organism":["Caenorhabditis elegans"],"full_dataset_link":["https://www.ebi.ac.uk/biostudies/studies/E-MTAB-15713"],"description":["This study uses individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) to map the direct RNA-binding sites of the PETISCO complex in Caenorhabditis elegans embryos. When bound to TOST-1, PETISCO stabilizes replication-dependent histone mRNAs during oogenesis to ensure adequate maternal histone supply for early embryogenesis. To identify the direct RNA targets of PETISCO, we performed iCLIP using anti-TOFU-6 antibodies in embryos. This approach revealed highly specific enrichment of replication-dependent histone transcripts, with crosslinking sites concentrated in the 3' regions of these mRNAs, particularly 12 nucleotides upstream of the conserved stem-loop structure."],"repository":["biostudies-arrayexpress"],"sample_protocol":["Nucleic Acid Extraction - RNA-protein complexes were isolated from the nitrocellulose membrane, treated with Proteinase K, and RNA extracted using phenol/chloroform.","Sequencing - Six replicates and two negative controls (without antibody) were pooled equimolarly and sequenced on Illumina NextSeq 500 (150 nt single-end reads).","Sample Collection - Wild-type worms were grown on egg plates and embryos harvested by bleaching. Embryos were UV cross-linked four times at 100 mJ/cm² (254 nm) in Worm Lysis Buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1.5 mM MgCl₂, 1 mM DTT, 0.1% Triton X-100) and snap-frozen as \\\"worm balls.\\\" DYNAL™ Dynabeads™ Protein G (100 μl) were conjugated with 2 μg TOFU-6 antibody, or no antibody, for 1 h at room temperature and washed twice. Embryo extracts (1 mg total protein per replicate) were treated with RNase I and TURBO DNase at 37°C for 3 min, clarified by centrifugation, and filtered. Lysates were incubated with antibody-conjugated beads, or no-conjugated beads, for 2 h at 4°C, washed, and treated with T4 PNK for RNA 3'-end dephosphorylation. L3-App adapter ligation was performed overnight at 16°C, followed by RNA 5'-end labelling with ³²P-γ-ATP (37°C, 5 min). Samples were run on 4-12% NuPAGE Bis-Tris gels, transferred to nitrocellulose membrane, and visualized by phosphoimaging.","Library Construction - After precipitation, reverse transcription was performed using SuperScript III, followed by second adapter ligation and cDNA amplification (18-24 cycles). Libraries were assessed using TapeStation and quantified by Qubit."],"figure_sub":["Organization","MINSEQE Score","Assays and Data","Processed Data","MAGE-TAB Files"],"data_protocol":["Data Transformation - Remove reads directly mapped at chromosome ends (their upstream/crosslink position does not exist) and create BAM index using Samtools (v1.10) and Bedtools (v2.29.2): samtools view -H SAMPLE.duprm.mapped.bam > SAMPLE.header; samtools view SAMPLE.duprm.mapped.bam > SAMPLE.body; bedtools bamtobed -i SAMPLE.duprm.mapped.bam | sort -k1,1 > SAMPLE.duprm.mapped.bed; join -t $'\\t' -j1 -e \\\"NA\\\" -a1 SAMPLE.duprm.mapped.bed CHROMOLENGTHTABLE > SAMPLE.duprm.mapped.len.bed; cat SAMPLE.duprm.mapped.len.bed | awk '{if(($2==0) || ($3>=$7)) printf \\\"%s\\t%s\\t%s\\t%s\\t%s\\t%s\\n\\\",$1,$2,$3,$4,$5,$6;}' > SAMPLE.idlist; awk 'FNR==NR && NF {a[$4];next} !($1 in a)' SAMPLE.idlist SAMPLE.body > SAMPLE.body.filtered; cat SAMPLE.header SAMPLE.body.filtered | samtools view -b - > SAMPLE.duprm.bam; samtools index SAMPLE.duprm.bam Extracting crosslink sites: BAM to BED shifting one base upstream using bedtools (v2.29.2): bedtools bamtobed -i SAMPLE.duprm.bam | bedtools shift -m 1 -p -1 -i stdin -g CHROMOLENGTHTABLE | sort -k1,1 -k2,2n > SAMPLE.shifted1bp.bed; BED to bedGraph considering only 5' end positions using bedtools (v2.29.2): bedtools genomecov -bg -strand + -5 -i SAMPLE.shifted1bp.bed -g CHROMOLENGTHTABLE > SAMPLE_crosslinks.duprm.plus.bedgraph; bedtools genomecov -bg -strand - -5 -i SAMPLE.shifted1bp.bed -g CHROMOLENGTHTABLE > SAMPLE_crosslinks.duprm.minus.bedgraph  Extracting read end positions of trimmed reads: Filter for truly adapter-trimmed reads (i.e. the end of the read is truly the end of the RNA insert) using Samtools (v1.10): samtools view -h SAMPLE.duprm.bam | awk -v maxlen=129 '{if($1 ~ /^@/) print; else { if(length($10)<=maxlen) print }}' | samtools view -bh - > SAMPLE.duprm.trimmed.bam; Create bedGraph files of last positions of trimmed reads using Bedtools (v2.29.2): bedtools bamtobed -i SAMPLE.duprm.trimmed.bam | sort -k1,1 -k2,2n > SAMPLE.duprm.trimmed.bed; bedtools genomecov -bg -strand + -3 -i SAMPLE.duprm.trimmed.bed -g CHROMOLENGTHTABLE > SAMPLE_trimmedReadEnds.duprm.plus.bedgraph; bedtools genomecov -bg -strand - -3 -i SAMPLE.duprm.trimmed.bed -g CHROMOLENGTHTABLE > SAMPLE_trimmedReadEnds.duprm.minus.bedgraph bedGraph to bigWig using bedGraphToBigWig of the UCSC tool suite (v385) Processed data: - bigWig (“_crosslinks” = crosslink events per nucleotide) - bigWig (“_trimmedReadEnds” = read ends per nucleotide)","Sequence Alignment - Quality control: FastQC (v0.11.9) Barcode and adapter trimming using Flexbar (v3.5.0): flexbar -r SAMPLE.fastq.gz --zip-output GZ --threads 4 --stdout-log --barcodes samplebarcode.fasta --barcode-unassigned --barcode-trim-end LTAIL --barcode-error-rate 0 --adapter-seq AGATCGGAAGAGCGGTTCAG --adapter-trim-end RIGHT --adapter-error-rate 0.1 --adapter-min-overlap 1 --min-read-length 15 --length-dist --umi-tags --target SAMPLE.trimmed (using sample barcodes: Ctrl_rep1: NNNNNCGTGATNNNN, Ctrl_rep2: NNNNNACATCGNNNN, TOFU6_rep1: NNNNNGCCTAANNNN, TOFU6_rep2: NNNNNTGGTCANNNN, TOFU6_rep3: NNNNNCACTGTNNNN, TOFU6_rep4: NNNNNATTGGCNNNN, TOFU6_rep5: NNNNNGATCTGNNNN, TOFU6_rep6: NNNNNTCAAGTNNNN) Duplicate removal based on sequence identity of reads (including UMIs): zcat SAMPLE.trimmed.fastq.gz | paste - - - - | awk '{split($1,v,\\\"_\\\"); printf \\\"%s\\t%s%s\\t%s\\t%s\\n\\\",v[1],v[2],$2,$3,$4;}' | sort -u -t $'\\t' -k2,2 | awk '{printf \\\"%s_%s\\t%s\\t%s\\t%s\\n\\\",$1,substr($2,1,9),substr($2,10),$3,$4;}' | tr '\\t' '\\n' | gzip > SAMPLE.duprm.fastq.gz Mapping with STAR (v2.7.3a) and removal of secondary hits and sorting using Samtools (v1.10): STAR --runMode alignReads --genomeLoad NoSharedMemory --limitGenomeGenerateRAM 31000000000 --limitIObufferSize 150000000 --limitBAMsortRAM 4000000000 --outMultimapperOrder Random --outReadsUnmapped Fastx --outSJfilterReads Unique --readFilesCommand zcat --outStd SAM --alignEndsType Extend5pOfRead1 --genomeDir STARindex_Ensembl_WBcel235 --sjdbGTFfile Caenorhabditis_elegans.WBcel235.108.gtf --sjdbOverhang 134 --runThreadN 1 --outFilterMismatchNoverReadLmax 0.04 --outFilterMismatchNmax 999 --outFilterMultimapNmax 999 --alignIntronMin 21 --outSAMattributes All --winAnchorMultimapNmax 100 --readFilesIn SAMPLE.duprm.fastq.gz | samtools view -F 256 -bhSu -@ 1 - | samtools sort -O bam -@ 1 - > SAMPLE.duprm.mapped.bam"],"omics_type":["Metabolomics","Unknown","Transcriptomics","Genomics","Proteomics"],"instrument_platform":["NextSeq 500"],"study_type":["RIP-seq"],"species":["Caenorhabditis elegans"],"pubmed_authors":["Rene Ketting"],"additional_accession":[]},"is_claimable":false,"name":"iCLIP-seq identifies direct binding of PETISCO complex to replication-dependent histone mRNAs in Caenorhabditis elegans embryos","description":"This study uses individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) to map the direct RNA-binding sites of the PETISCO complex in Caenorhabditis elegans embryos. When bound to TOST-1, PETISCO stabilizes replication-dependent histone mRNAs during oogenesis to ensure adequate maternal histone supply for early embryogenesis. To identify the direct RNA targets of PETISCO, we performed iCLIP using anti-TOFU-6 antibodies in embryos. This approach revealed highly specific enrichment of replication-dependent histone transcripts, with crosslinking sites concentrated in the 3' regions of these mRNAs, particularly 12 nucleotides upstream of the conserved stem-loop structure.","dates":{"release":"2025-11-11T00:00:00Z","modification":"2026-05-27T17:48:22.796Z","creation":"2025-10-14T14:43:50.635Z"},"accession":"E-MTAB-15713","cross_references":{"ENA":["ERP182149"],"EFO":["EFO_0002944","EFO_0004170","EFO_0005310","EFO_0004917","EFO_0005518","EFO_0003816","EFO_0004184"]}}