{"database":"biostudies-arrayexpress","file_versions":[],"scores":null,"additional":{"submitter":["Megan Bergkessel"],"organism":["Pseudomonas aeruginosa"],"software":["Transit package Tn-Seq Pre-Processor tool, BWA-MEM, subread FeatureCounts","Degust implementation of Voom/Limma"],"full_dataset_link":["https://www.ebi.ac.uk/biostudies/studies/E-MTAB-15727"],"description":["We performed Tn-Seq to identify genetic fitness determinants for starvation survival in Pseudomonas aeruginosa. A pooled mutant library of approximately 180,000 randomly inserted transposon mutants was grown into stationary phase in rich medium (lysogeny broth) and an aliquot of this mutant pool was taken for gDNA extraction and high throughput sequencing of the transposon-genome junctions to determine and count the sites of transposon insertion. This culture was then split and starved for either nitrogen or carbon for 48 hours. Additional aliquots were taken and allowed to grow out in LB medium for 2-3 generations before harvesting for gDNA extraction. The remaining cultures were then split and transitioned again into either carbon starvation or nitrogen starvation for 24 more hours, after which final aliquots were taken, allowed 3-4 generations of outgrowth in LB, and harvested for extracting gDNA. All time points were sampled in biological triplicate in two separate experiments, for a total of 6 replicates. Transposon insertion counts per gene were tallied from high-throughput sequencing data and used to calculate changes from one condition to the next, in order to infer mutation impacts on fitness. Genes whose transpsoson insertion counts decreased in a starvation condition were inferred to benefit survival in that starvation condition, while genes whose transposon insertion counts increased were inferred to perform functions that limited fitness in that condition."],"repository":["biostudies-arrayexpress"],"sample_protocol":["Sample Collection - Aliquots of the UCBPP- PA14 transposon mutant library were thawed and 50 μL was used to inoculate 50 mL of LB. Stationary phase samples (~2mL) were taken after 24 hours growth, pelleted and frozen. The remainder of each LB culture was then pelleted, washed and resuspended to a final OD of 0.2 in 40 mL of either carbon starvation or nitrogen starvation MOPS minimal media. 0.5 OD units were collected after 48 hours incubation, washed, and resuspended in 5 mL LB for outgrowth. Following 2 hours of outgrowth, with cultures reaching an OD of ~ 0.6, cultures were pelleted and frozen. The remaining cultures were split in half, pelleted, washed thoroughly in MOPS minimal media lacking both carbon and nitrogen sources, and resuspended in 10 mL of either nitrogen starvation or carbon starvation MOPS minimal media, achieving an OD of ~0.05. Transitioned cultures were incubated for 24 hours at 37 ̊C shaking before sampling. The entire remaining cultures were pelleted and resuspended in 5 mL of LB for outgrowth. Following 2 hours of outgrowth, with cultures reaching an OD of ~ 0.6, cultures were pelleted and frozen. The remaining cultures were split in half, pelleted, washed thoroughly in MOPS minimal media lacking both carbon and nitrogen sources, and resuspended in 10 mL of either nitrogen starvation or carbon starvation MOPS minimal media, achieving an OD of ~0.05. Transitioned cultures were incubated for 24 hours at 37 ̊C shaking before sampling. The entire remaining cultures were pelleted and resuspended in 5 mL of LB for outgrowth. Following 2 hours of outgrowth, with cultures reaching an OD of ~ 0.6, cultures were pelleted and frozen.","Library Construction - Genomic DNA (~5 µg) was sheared into 250 bp fragments by sonication using the QSonica Q800R sonicator (Amplitude 25%: 20x cycles of 15s on/off) and end repaired using the NEBNext End Repair Module (New England Biolabs). A polyC tail was added to 1 µg of end repaired DNA using Terminal Deoxynucleotidyl Transferase (NEB) with a mixture of 95% dCTP and 5% ddCTP as a substrate. Residual C-tailing reagents were removed using NucleoSpin™ Gel and PCR Clean-up columns (Macherey-Nagel) and DNA fragments containing transposon insertion sites were amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotide primers TnSeq_Rnd1_F (CTGGATGGAAAACGGGAAAGGTTCCGTCCA) and TnSeq_Rnd1_R (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGGGGGGGGGGGGGG). Sample clean-up and size selection was performed using magnetic AMPure XP beads (Beckman). An initial incubation with 0.9 volumes of bead solution was used to remove long DNA fragments (>250 bp) and the fragments of interest were adsorbed from the resulting supernatant using an additional 0.3 volumes of bead solution. The beads were washed twice with 80% ethanol prior to elution of the DNA in 30 µl ultrapure H2O. TnSeq_Rnd2_F primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) was used in conjunction with NEB index primers (NEBNext Multiplex Oligos for Illumina, New England Biolabs) to attach sequencing primers and index sequences. PCR products were purified by cleanup with AMPure XP beads, using 1.1 volumes of beads. The beads were washed twice with 80% ethanol prior to elution of the DNA in 30 µl ultrapure H2O. The quality and concentration of DNA was assessed using the qubit High Sensitivity DNA kit and the High Sensitivity DNA ScreenTape (Agilent) and an Agilent 2200 TapeStation, and samples were pooled for sequencing. Two separate sequencing runs were conducted.","Growth Protocol - To create the pooled mutant library, the randomly inserting Tn5-based transposon delivery plasmid pIT2 was conjugated into UCBPP-PA14 to produce a diverse transposon mutant library. UCBPP-PA14 and E. coli SM10(lambda pir) carrying the transposon-bearing pIT2 plasmid were streaked onto LB agar plates and LB + 100 μg/mL carbenicillin agar plates respectively. Following overnight incubation at 37 ̊C, cells were scraped from each plate and resuspended in 1 mL of LB. Each suspension was then pelleted and washed once in LB before being resuspended in LB to an optical density of 50 and 100 OD units for PA14 and SM10(lambda pir)/pIT2 respectively. Aliquots (100µL) of each dense culture were then mixed and 50 μL of this mixture was spotted onto LB agar plates and incubated at 37 ̊C for 2.5 hours. Spots were then scraped and resuspended in 16 mL of LB before 100 μL aliquots were spread onto 160 individual LB + 60 μg/mL tetracycline + 10 μg/mL chloramphenicol agar plates. Plates were incubated at 37 ̊C for 24 hours to select for transposon-integrated PA14. The roughly 180,000 resultant colonies were scraped and collected from the plates and made to an OD of ~5 in LB. Glycerol was added to the pooled transposon mutant library which was then aliquoted and stored at - 70 ̊C until its application in subsequent experiments.","Nucleic Acid Extraction - DNA was extracted from frozen bacterial cell pellets and gDNA was extracted using the Monarch DNA extraction kit (New England Biolabs) using the extended protocol for Gram negative bacteria.","Sequencing - Pooled DNA libraries were sequenced on the Illumina NextSeq2000 instrument with a P1 reagent kit. Approximately 2.2 - 4.6 million single-end 100 bp reads were obtained per sample."],"figure_sub":["Organization","MINSEQE Score","Assays and Data","Processed Data","MAGE-TAB Files"],"data_protocol":["Sequence Alignment - Raw FASTQ files were processed for analysis using the Tn-Seq Pre-Processor (TPP) tool from the Transit package, which finds and filters the transposon sequence from each read and maps the remaining genome sequence to a reference genome using BWA-MEM. Approximately 2.5 - 4.5 million reads per sample were successfully mapped to the UCBPP-PA14 genome (NC_008463.1). Output.sam files were used in conjunction with the genome annotation to summarise counts per gene using the FeatureCounts algorithm of the subread software package.","Data Transformation - Subsequent analyses used a combined dataset from two independent experiments, with each individual sampling timepoint represented by at least five biological replicates. FeatureCounts data were uploaded to Degust, an online tool for the exploration, analyses and visualisation of large sequencing datasets. Analyses of differential read counts was then performed on select comparisons of interest using a Voom/Limma differential expression method."],"omics_type":["Metabolomics","Unknown","Transcriptomics","Genomics","Proteomics"],"instrument_platform":["NA","QSonica Q800R","NextSeq 2000"],"study_type":["genotyping by high throughput sequencing"],"species":["Pseudomonas aeruginosa"],"pubmed_authors":["Megan Bergkessel"],"additional_accession":[]},"is_claimable":false,"name":"Transposon insertion sequencing (Tn-Seq) to identify fitness determinants during nitrogen starvation, carbon starvation, and transitions between them in Pseudomonas aeruginosa","description":"We performed Tn-Seq to identify genetic fitness determinants for starvation survival in Pseudomonas aeruginosa. A pooled mutant library of approximately 180,000 randomly inserted transposon mutants was grown into stationary phase in rich medium (lysogeny broth) and an aliquot of this mutant pool was taken for gDNA extraction and high throughput sequencing of the transposon-genome junctions to determine and count the sites of transposon insertion. This culture was then split and starved for either nitrogen or carbon for 48 hours. Additional aliquots were taken and allowed to grow out in LB medium for 2-3 generations before harvesting for gDNA extraction. The remaining cultures were then split and transitioned again into either carbon starvation or nitrogen starvation for 24 more hours, after which final aliquots were taken, allowed 3-4 generations of outgrowth in LB, and harvested for extracting gDNA. All time points were sampled in biological triplicate in two separate experiments, for a total of 6 replicates. Transposon insertion counts per gene were tallied from high-throughput sequencing data and used to calculate changes from one condition to the next, in order to infer mutation impacts on fitness. Genes whose transpsoson insertion counts decreased in a starvation condition were inferred to benefit survival in that starvation condition, while genes whose transposon insertion counts increased were inferred to perform functions that limited fitness in that condition.","dates":{"release":"2026-03-04T00:00:00Z","modification":"2026-03-04T16:58:08.401Z","creation":"2025-10-14T22:58:02.576Z"},"accession":"E-MTAB-15727","cross_references":{"ENA":["ERP182175"],"EFO":["EFO_0002944","EFO_0004170","EFO_0003789","EFO_0002771","EFO_0004917","EFO_0005518","EFO_0003816","EFO_0004184"]}}