<HashMap><database>biostudies-arrayexpress</database><scores/><additional><submitter>Stijn Verwaerde</submitter><organism>Mus musculus</organism><full_dataset_link>https://www.ebi.ac.uk/biostudies/studies/E-MTAB-16099</full_dataset_link><description>Single cell RNA sequencing of the lung in steady state, after 1 or 3 doses of IL-33 or after HDM treatment  Exp1: steady state lung cells (both CD45- as CD45+) from 4 untreated mice. Cells from distinct replicates are labeled with unique HTO barcodes. Exp2: lung cells (both CD45- as CD45+) from 2 mice (PBS intratracheal treatment), 4 mice (1xIL33 intratracheal treatment) and 4 mice (3 x IL33 intratracheal treatment). Cells from distinct replicates are labeled with unique HTO barcodes. Exp3: lung, bone marrow and blood cells (CD45+ CD3- CD19-) from 3 mice (House dust mite intratracheal (HDM) treatment and 14 days later PBS intranasal treatment on 4 consecutive days) and 3 mice (HDM treatment and 14 days later HDM intranasal treatment on 4 consecutive days). Mice were pooled and different organs were labeled with unique HTO barcodes.  In all cases, collection of the samples was performed 24 hours after the last treatment.  More experimental details can be found in the STAR methods section of the publication.</description><repository>biostudies-arrayexpress</repository><sample_protocol>Library Construction - The DNA libraries were prepared using the GemCode Single Cell 3′ Gel Bead and Library kit, version NextGEM 3.1 (10× Genomics) according to the manufacturer's instructions with the addition of amplification primers (3 nM, 5′CCTTGGCACCCGAGAATT*C*C and 5′GTGACTGGAGTTCAGACGTGTGC*T*C) during cDNA amplification to enrich the TotalSeq-A cell surface protein and/or hashtag oligos. Size selection with SPRIselect Reagent Kit (Beckman Coulter, B23318) was used to separate amplified cDNA molecules for 3′ gene expression and cell surface protein construction. TotalSeq-A protein library construction including sample index Polymerase Chain Reaction (PCR) using Illumina's Truseq Small RNA primer sets and SPRIselect size selection was performed according to the manufacturer's instructions.</sample_protocol><sample_protocol>Sample Collection - Exp1: 4 untreated C57BL6j mice were sacrificed and lung single cell suspensions were created. The cells were incubated with fluorophore labeled antibodies for FACS and TotalSeq C library for 30 minutes on 4°C. 30000 CD45-, 15000 CD45+CD64+ and 15000 CD45+CD64- cells per biological replicate were FACS sorted. Cells were pooled in the same eppendorf tube, diluted into a final concentration of 2000 cells/ μl and loaded on the 10X chromium device.</sample_protocol><sample_protocol>Library Construction - The DNA libraries were prepared using the GemCode Single Cell 5′ Gel Bead and Library kit, version Next GEM v2 according to the manufacturer's instructions (10x Genomics, User Guide CG000330). Size selection with SPRIselect Reagent Kit (Beckman Coulter, B23318) was used to separate amplified cDNA molecules for 5′ gene expression and cell surface protein construction. The cDNA content of pre-fragmentation and post-sample index PCR samples was analyzed using the 2100 BioAnalyzer (Agilent).</sample_protocol><sample_protocol>Nucleic Acid Extraction - The DNA libraries were prepared using the GemCode Single Cell 5′ Gel Bead and Library kit, version Next GEM v2 according to the manufacturer's instructions (10x Genomics, User Guide CG000330). Size selection with SPRIselect Reagent Kit (Beckman Coulter, B23318) was used to separate amplified cDNA molecules for 5′ gene expression and cell surface protein construction. The cDNA content of pre-fragmentation and post-sample index PCR samples was analyzed using the 2100 BioAnalyzer (Agilent).</sample_protocol><sample_protocol>Sample Collection - Exp2: Mice were treated with PBS, 1 x 100 ng IL-33 intratreacheally or 3 x 100 ng IL-33 intratracheally. Mice were sacrificed 24h after the last treatment and single cell lung suspensions were created. Cells were incubated with FACS antibodies as well as TotalSeq A hashtag antibodies. 12000 CD45-, 3000 CD45+ CD11c+ SiglecF+ alveolar macrophages, 3000 CD45+ lineage- CD11c- SiglecF- CD90+ ST2+ ILC2s and 12000 AM and ILC2 excluded CD45+ cells were FACS purified per mouse and pooled together per condition. Cells were diluted to a final concentration of 1000/μl and loaded on the 10X Chromium device.</sample_protocol><sample_protocol>Sequencing - NovaSeq6000 paired sequencing 28-10-10-90 (R1-I1-I2-R2)  (+ 1% PhiX)</sample_protocol><sample_protocol>Sample Collection - Exp3: Mice were sensitized with 3 μg house dust mite extract (HDM - ALK) intratracheally and challenged two weeks later with PBS or 10 μg of HDM extract intranasally on 4 consecutive days. Lungs, bone marrow and blood was collected 24 hours after the last treatment. 3 mice per condition were pooled. Single cell suspensions of lung, bone marrow and blood were stained with FACS sort antibodies combined with CITEseq antibodies (TotalSeq-A)  in 25 μl mix containing PBS, 0.04% BSA,  TruStain FcX Block for 30 minutes on ice. The CITE-Seq panel contains 170 unique oligoconjugated antibodies and isotype controls. Different organs were tagged and pooled using TotalSeq-A hashtag antibodies. Sorting was performed to select single alive Ter119- CD3e- CD19- cells into a tube containing anti-PE CITEseq antibody to label CD101-PE+ cells. Per condition, first 45.000 lung cells were sorted, then 20.000 blood cells and 10.000 bone marrow cells into the same 1,5ml Eppendorf.</sample_protocol><figure_sub>Organization</figure_sub><figure_sub>MINSEQE Score</figure_sub><figure_sub>Assays and Data</figure_sub><figure_sub>Processed Data</figure_sub><figure_sub>MAGE-TAB Files</figure_sub><data_protocol>Data Transformation - The Cell Ranger pipeline (10× Genomics, version 6.0.0) was used to perform sample demultiplexing and to generate FASTQ files for read 1, read 2, and the i7 sample index for the gene expression and cell surface protein libraries. Read 2 of the gene expression libraries was mapped to the reference genome (mouse mm10) using STAR. Subsequent barcode processing, unique molecular identifiers filtering, and gene counting was performed using the Cell Ranger suite version 6.0.0 (10× Genomics) and Seurat. For further analysis, we used the filtered featurebarcode matrix generated by CellRanger (v6.0.0, 10× Genomics).</data_protocol><omics_type>Metabolomics</omics_type><omics_type>Unknown</omics_type><omics_type>Transcriptomics</omics_type><omics_type>Genomics</omics_type><omics_type>Proteomics</omics_type><instrument_platform>10X Chromium</instrument_platform><instrument_platform>FACS BD Aria II &amp; III</instrument_platform><instrument_platform>Illumina NovaSeq 6000</instrument_platform><instrument_platform>Cellranger</instrument_platform><study_type>RNA-seq of coding RNA from single cells</study_type><species>Mus musculus</species><pubmed_title>Type-2 Innate Lymphocytes Trigger an Inflammatory Switch in Alveolar Macrophages</pubmed_title><pubmed_authors>Stijn Verwaerde</pubmed_authors><pubmed_authors>Stijn Verwaerde, Jean-François Hastir, Sjoerd Schetters, Ursula Smole, Leen Seys,  Antonio P. Baptista, Kieran English, Martijn J. Schuijs, Helena Aegerter, Karel FA Van Damme, Aimée Bugler-Lamb, Nikita Gerebtsov, Wendy Toussaint, Tatsuma Ban, Tomohiko Tamura,  Florent Ginhoux, Zhaoyuan Liu, Wouter Saelens, Hamida Hammad, Martin Guilliams, Bart N. Lambrecht1, 2,8</pubmed_authors></additional><is_claimable>false</is_claimable><name>Single-cell RNA sequencing of murine lung in steady state, after IL-33 treatment or HDM treatment</name><description>Single cell RNA sequencing of the lung in steady state, after 1 or 3 doses of IL-33 or after HDM treatment  Exp1: steady state lung cells (both CD45- as CD45+) from 4 untreated mice. Cells from distinct replicates are labeled with unique HTO barcodes. Exp2: lung cells (both CD45- as CD45+) from 2 mice (PBS intratracheal treatment), 4 mice (1xIL33 intratracheal treatment) and 4 mice (3 x IL33 intratracheal treatment). Cells from distinct replicates are labeled with unique HTO barcodes. Exp3: lung, bone marrow and blood cells (CD45+ CD3- CD19-) from 3 mice (House dust mite intratracheal (HDM) treatment and 14 days later PBS intranasal treatment on 4 consecutive days) and 3 mice (HDM treatment and 14 days later HDM intranasal treatment on 4 consecutive days). Mice were pooled and different organs were labeled with unique HTO barcodes.  In all cases, collection of the samples was performed 24 hours after the last treatment.  More experimental details can be found in the STAR methods section of the publication.</description><dates><release>2025-12-12T00:00:00Z</release><modification>2026-05-27T15:02:22.109Z</modification><creation>2025-11-12T16:23:32.404Z</creation></dates><accession>E-MTAB-16099</accession><cross_references><ENA>ERP187921</ENA><EFO>EFO_0002944</EFO><EFO>EFO_0004170</EFO><EFO>EFO_0005684</EFO><EFO>EFO_0005518</EFO><EFO>EFO_0003816</EFO><EFO>EFO_0004184</EFO></cross_references></HashMap>