biostudies-arrayexpressDibin BabyArabidopsis thalianahttps://www.ebi.ac.uk/biostudies/studies/E-MTAB-16555Plants need iron but excess is harmful. Iron uptake transcription factor bHLH104 is negatively controlled by Fe-binding E3 ligase BTS. We show that three–amino acid terminal sequence of bHLH104 controls its breakdown by the BTS pathway. Removing PAA keeps bHLH104 active, driving constant iron uptake and iron accumulation phenotypes. Targeting this motif can be a strategy for crop biofortification. RNA-seq was performed on Col-0 and transgenic Arabidopsis lines expressing wild-type bHLH104, bHLH104 lacking the PAA short sequence(bHLH104dPAA). Two developmental stages were analyzed: 10-day-old seedlings (shoots and roots) and 30-day-old reproductive stage plants (young leaves, old leaves, roots). Plants were grown under iron-sufficient (+Fe) or iron-deficient (-Fe) conditions. Poly-A selected, strand-specific libraries were sequenced on Illumina NovaSeq 6000 (2×150 bp, ~8 Gb/sample).biostudies-arrayexpressGrowth Protocol - Seeds of Arabidopsis thaliana Col-0 (wild-type) and transgenic lines were surface sterilized and stratified at 4°C for 2 days before plating. Seedling stage (10 days): Seeds were germinated and grown vertically on modified Hoagland agar medium containing 1.5 mM Ca(NO₃)₂·4H₂O, 0.5 mM KH₂PO₄, 1.25 mM KNO₃, 0.75 mM MgSO₄·7H₂O, 50 µM H₃BO₃, 25 µM KCl, 10 µM MnSO₄·H₂O, 2 µM ZnSO₄·7H₂O, 1.5 µM CuSO₄·5H₂O, and 0.075 µM (NH₄)₆Mo₇O₂₄, supplemented with 1% (w/v) sucrose and 1.4% (w/v) plant agar, pH 5.8. Iron was supplied as 50 µM Fe(III)-EDTA for +Fe conditions or omitted for -Fe conditions. Seedlings were grown under long-day photoperiods (16 h light/8 h dark) at 21°C with 120 μmol m⁻² s⁻¹ white light (CLF Plant Climatics) for 10 days before tissue collection. Reproductive stage (30 days): Seedlings were initially grown on Hoagland agar plates for 12 days, then transferred to hydroponic culture with quarter-strength Hoagland solution containing 0.75 mM Ca(NO₃)₂, 0.625 mM KNO₃, 0.25 mM KH₂PO₄, 0.375 mM MgSO₄, 25 µM H₃BO₃, 25 µM KCl, 5 µM MnSO₄, 1 µM ZnSO₄, 0.75 µM CuSO₄, and 0.0375 µM (NH₄)₆Mo₇O₂₄. Iron was supplied as 25 µM FeNaEDTA (+Fe). Nutrient solution was replaced every three days with continuous aeration. Plants were grown under the same light and temperature conditions until 27 days after germination, then subjected to +Fe (25 µM FeNaEDTA) or -Fe (no iron) treatment for 3 days before harvest on day 30.Sample Collection - Tissues were harvested from plants at specified developmental stages. For 10-day-old seedlings, shoots and roots were collected separately. For 30-day-old plants, young leaves, old leaves, and roots were collected separately. All tissues were immediately frozen in liquid nitrogen upon harvest and stored at -80°C until RNA extraction. Three independent biological replicates were collected for each genotype-treatment-tissue combination, with each replicate consisting of tissue pooled from multiple plants.Library Construction - mRNA library construction was performed by BMK Gene (Biomarker Technologies) using the VAHTS Universal V8 RNA-seq Library Prep Kit for Illumina (catalog no. NR605, Vazyme) in strict accordance with the manufacturer's protocol. Strand-specific mRNA libraries were constructed. Adapter sequences used were: adapter3 = \"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\" and adapter5 = \"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT\". Library quality was assessed using Qsep-400 with standard DNA markers. Library concentration was quantified using Qubit 3.0 fluorometer with Qubit dsDNA HS Assay Kit.Sequencing - Performer: BMK Gene (Biomarker Technologies) Hardware: Illumina NovaSeq X Description: Library preparations were sequenced on the Illumina NovaSeq X platform generating 150 bp paired-end reads. Sequencing was performed by BMK Gene (Biomarker Technologies, Project ID: BMK241211-CL879-ZX01-0103).Nucleic Acid Extraction - Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen) with on-column DNase digestion. Frozen tissues were homogenized under liquid nitrogen using a Heidolph RZR 2020 and Precellys 24 homogenizer. RNA quality and concentration were assessed by measuring absorbance at 260/280 nm using a TECAN Infinite M200 PRO plate reader. Only samples with 260/280 ratios between 2.1-2.25 and concentrations >90 ng/µl were used for library preparation.OrganizationMINSEQE ScoreAssays and DataProcessed DataMAGE-TAB FilesData Transformation - Raw sequencing data in FASTQ format were processed using the PlugNSeq pipeline, an automated mRNA-seq analysis workflow designed for organisms with well-annotated genomes. PlugNSeq integrates quality control, read alignment, quantification, and differential expression analysis steps. Quality assessment was performed on raw reads, followed by adapter trimming and quality filtering. Reads were aligned to the Arabidopsis thaliana reference genome (TAIR10) and gene expression levels were quantified. Transcript abundance was normalized and expressed as TPM (Transcripts Per Million) values. Differential gene expression analysis was conducted to identify significantly regulated genes between experimental conditions (genotypes, iron treatments, tissues, and developmental stages). Gene ontology enrichment and pathway analyses were performed on differentially expressed gene sets to identify biological processes and pathways affected by experimental treatments. Reference: Mai HJ, Pateyron S, Bauer P. PlugNSeq: An Easy, Rapid, and Streamlined mRNA-Seq Data Analysis Pipeline Empowering Insightful Exploration with Well-Annotated Organisms, Requiring Minimal Bioinformatic Expertise. Methods Protoc. 2024 Sep 27;7(5):72. doi: 10.3390/mps7050072.MetabolomicsUnknownTranscriptomicsGenomicsProteomicsIllumina NovaSeq XRNA-seq of coding RNAArabidopsis thalianaDibin BabyfalseTranscriptomic analysis of PAA short sequence-dependent regulation of bHLH104 in Arabidopsis thaliana iron homeostasisPlants need iron but excess is harmful. Iron uptake transcription factor bHLH104 is negatively controlled by Fe-binding E3 ligase BTS. We show that three–amino acid terminal sequence of bHLH104 controls its breakdown by the BTS pathway. Removing PAA keeps bHLH104 active, driving constant iron uptake and iron accumulation phenotypes. Targeting this motif can be a strategy for crop biofortification. RNA-seq was performed on Col-0 and transgenic Arabidopsis lines expressing wild-type bHLH104, bHLH104 lacking the PAA short sequence(bHLH104dPAA). Two developmental stages were analyzed: 10-day-old seedlings (shoots and roots) and 30-day-old reproductive stage plants (young leaves, old leaves, roots). Plants were grown under iron-sufficient (+Fe) or iron-deficient (-Fe) conditions. Poly-A selected, strand-specific libraries were sequenced on Illumina NovaSeq 6000 (2×150 bp, ~8 Gb/sample).2026-09-18T00:00:00Z2026-09-18T19:43:17.343Z2026-01-21T14:51:40.018ZE-MTAB-16555ERP187998EFO_0002944EFO_0004170EFO_0003789EFO_0005518EFO_0003816EFO_0003738EFO_0004184