{"database":"biostudies-arrayexpress","file_versions":[],"scores":null,"additional":{"submitter":["Lucille Lopez-Delisle"],"organism":["Mus musculus"],"software":["R, edgeR","cutadapt, STAR"],"full_dataset_link":["https://www.ebi.ac.uk/biostudies/studies/E-MTAB-16705"],"description":["UCP1-expressing brown and beige adipocytes are known to play an important role in thermogenic adaptation in mammals. Recent studies have proposed that these cells also exert beneficial effects on metabolic health. Therefore, we aimed to identify the consequences of UCP1+ cell loss on the metabolism of adult mice under standard conditions and upon cold challenge. In this study, UCP1+ cells were ablated in adult mice, and liver tissue was collected at room temperature or following acute cold exposure. We intended to compare the transcriptional profile of the liver between control and UCP1+ cell-ablated mice in order to identify liver-specific adaptations to severe UCP1+ cell loss under basal conditions and during acute cold stress."],"repository":["biostudies-arrayexpress"],"sample_protocol":["Nucleic Acid Extraction - Total RNA was extracted using the RNeasy Mini Kit (Qiagen, #74104).","Sample Collection - Mice were sacrificed and livers were rapidly dissected.","Library Construction - RNA quantification was performed using a Qubit fluorometer (ThermoFisher Scientific) and RNA integrity assessed using a Bioanalyzer (Agilent Technologies). The Illumina Stranded mRNA Prep, Ligation kit was used for the library preparation with 500 ng of total RNA as input. The molarity and quality of the libraries were assessed using Qubit and Tapestation (DNA High sensitivity chip).","Sequencing - The libraries were sequenced on an Illumina NovaSeq 6000 sequencer for single-end 100 reads.","Sample Treatment - To induce ablation of UCP1+ cells, 6–7-week-old UCP1-DTR mice received repeated intraperitoneal injections of diphtheria toxin (DT; Sigma, 126 ng per injection). 3 DT injections were administered on days 1–3, followed by continued DT administration three times per week (8 injections in total). Control mice received saline injections according to the same schedule. One day after the final injection, mice were either sacrificed at room temperature (CTRL_RT and ABL_RT) or subjected to 3 hours of acute cold exposure at 6°C prior to sacrifice (CTRL_CE and ABL_CE)."],"figure_sub":["Organization","MINSEQE Score","Assays and Data","Processed Data","MAGE-TAB Files"],"data_protocol":["Sequence Alignment - All scripts to reproduce processed files from raw data are available at https://gitlab.unige.ch/herrera/allrnaseqscriptsfromvartanovaetal2026. Adapters and bad quality bases were removed from fastq files using cutadapt version 5.0 (-a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -q 30 -m 15). Filtered reads were aligned on mm39 using STAR version 2.7.11b with the ENCODE parameters and a custom gtf based on ensembl version 113 (https://doi.org/10.5281/zenodo.15166331). Counts per gene was computed at the same time with --quantMode GeneCounts.","Data Transformation - All counts from STAR were aggregated in a table called AllHTSeqCounts.txt where each row is a gene and each column is a sample. The gene length was determined as the median length across all transcripts of a gene. Counts were converted to FPKM values using calcNormFactors and rpkm functions from the edgeR package version 4.4.2. These values are provided in the EdgeR_RPKM.txt.gz file."],"omics_type":["Unknown","Transcriptomics","Genomics","Proteomics"],"instrument_platform":["Illumina NovaSeq 6000"],"study_type":["RNA-seq of total RNA"],"species":["Mus musculus"],"pubmed_authors":["Valeriia Vartanova","Daniel Oropeza","Marta Perez Frances","Fabrizio Thorel","Lucille Lopez-Delisle","Pedro Herrera"],"additional_accession":[]},"is_claimable":false,"name":"RNA-seq of liver transcriptome of  UCP1+ cell-ablated mice at room temperature and upon acute cold exposure","description":"UCP1-expressing brown and beige adipocytes are known to play an important role in thermogenic adaptation in mammals. Recent studies have proposed that these cells also exert beneficial effects on metabolic health. Therefore, we aimed to identify the consequences of UCP1+ cell loss on the metabolism of adult mice under standard conditions and upon cold challenge. In this study, UCP1+ cells were ablated in adult mice, and liver tissue was collected at room temperature or following acute cold exposure. We intended to compare the transcriptional profile of the liver between control and UCP1+ cell-ablated mice in order to identify liver-specific adaptations to severe UCP1+ cell loss under basal conditions and during acute cold stress.","dates":{"release":"2026-03-28T00:00:00Z","modification":"2026-03-28T02:03:54.821Z","creation":"2026-03-03T09:33:55.167Z"},"accession":"E-MTAB-16705","cross_references":{"ENA":["ERP189811"],"EFO":["EFO_0002944","EFO_0004170","EFO_0009653","EFO_0004917","EFO_0005518","EFO_0003816","EFO_0004184","EFO_0003969"]}}