<HashMap><database>biostudies-other</database><scores/><additional><omics_type>Unknown</omics_type><submitter/><species>Fungi</species><full_dataset_link>https://www.ebi.ac.uk/biostudies/studies/S-BSST2008</full_dataset_link><repository>biostudies-other</repository></additional><is_claimable>false</is_claimable><name>MIMt-ITS- A new ITS reference database for taxonomic assignment of metagenomic samples</name><description>MIMt-ITS is a database composed by sequences belonging to Fungi from Target Loci type material, Refseq genomes and Genbank genomes. 
To create MIMt-ITS database we collected all the ITS curated sequences from Target Loci and we append the ITS region (ITS1-5.8S-ITS2) from all the available genomes in RefSeq predicted with the tool RNAmmer-1.2.
The result is a complete database where most of the sequences are manually curated from RefSeq curators and are properly identified at species level, or even subspecies/strain. The full version of MIMt-ITS contains in addition ITS regions from the genome of new species deposited in Genbank, always keeping the full ITS region and identifying exactly the species name to get the full taxonomic classification.
Thus, all sequences included in both versions of MIMt-ITS are full length ITS and are well identified at all taxonomic levels.
MIMt-ITS has been trained to be used in QIIME and the classifier is also provided.

The database format is 
>SeqID&lt;tab>K__kingdom;P__phylum;C__class;O__order;F__family;G__genus;S__Genus_species
CGCGACTACGACTACGCTCAGACGCATCGTACGCAGACTACGTCAGTCAGACGTCGCTGCTCGTCGTACGTACGCT

There is also available a file with just the taxonomy associated to each sequence in the format:
SeqID&lt;tab>Full_taxonomy

and another one with species sharing the 100% of the sequence, so the programs could not differentiate between both species when a taxonomic classification is performed.

All files are available for both, only curated version and full version (including also predicted ITS regions from Genbank genomes)</description><dates><release>2025-05-02T00:00:00Z</release><modification>2026-05-27T15:56:21.257Z</modification><creation>2025-05-02T14:43:43.242Z</creation></dates><accession>S-BSST2008</accession><cross_references/></HashMap>