Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

20 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Nasopharyngeal carcinoma cell lines (expression analysis)

ABSTRACT: Three nasopharyngeal carcinoma cell lines (CNE1, CNE2, and HONE1) expression patterns against an immortalized nasopharyngeal epithelial cell line NP69. This study was done to screen genes consensually overexpressed in NPC. NP69 was used as normal control. The microarray analyses were done in a same batch.

ORGANISM(S): Homo sapiens

SUBMITTER: Zhong-Xi Huang

PROVIDER: E-GEOD-15047 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Nasopharyngeal carcinoma cell lines (expression analysis and copy number analysis)

Project description:This SuperSeries is composed of the following subset Series: GSE15047: Nasopharyngeal carcinoma cell lines (expression analysis) GSE15051: Nasopharyngeal carcinoma cell lines (copy number analysis) This study was designed to screen genes overexpression due to copy number gain.

2009-03-04 | E-GEOD-15098 | biostudies-arrayexpress

Nasopharyngeal carcinoma cell lines (copy number analysis)

Project description:Five NPC cell lines (HONE1, CNE1, CNE2, 5-8F, and 6-10B) and an immortalized nasopharyngeal epithelial cell line NP69 were evaluated with 250K SNP arrays (Affymetrix) to detect the genome-wide DNA copy number alterations. The same type of data of 45 Chinese samples from the HapMap project was used as normal control. Data was analyzed using GCOS (GeneChip operating software, Ver.1.4), GTYPE (GeneChip Genotyping Analysis Software, Ver.4.1), and CNAT (chromosome copy number analysis tool, Ver.4.0, BRLMM algorithm).

2009-03-04 | E-GEOD-15051 | biostudies-arrayexpress

Expression analysis for nasopharyngeal carcinoma cell lines (5-8F and 6-10B)

Project description:High metastatic nasopharyngeal carcinoma cell line 5-8F expression patterns against low metastatic nasopharyngeal carcinoma cell line 6-10B. This study was done to screen genes related with metastasis in NPC. The microarray analyses were done in a same batch. 6-10B cells are cultured and harvested at three different time points.

2009-12-10 | E-GEOD-15903 | biostudies-arrayexpress

Expression analysis for nasopharyngeal carcinoma cell lines 5-8F

Project description:High metastatic nasopharyngeal carcinoma cell line 5-8F expression patterns. This study was done to detect genes expressed in NPC cell line 5-8F. The microarray analyses were done in a same batch. cells are cultured and harvested at two different time points.

2009-12-10 | E-GEOD-15921 | biostudies-arrayexpress

Gene Expression data from human radioresistant and radiosensitive Nasopharyngeal Carcinoma Cells

Project description:Most of the NPC patients suffer from local recurrences and distant metastases within 1.5 years after radiotherapy due to radioresistance. Distinct patterns of gene expression and signatures were found in NPC, and have been used to associate them with cell proliferation, apoptosis, invasion and metastasis, but few gene expression profiling studies have been focused on the tumor radioresistance.We used gene expression microarray analyses to identify the difference of mRNA in radioresistant NPC CNE2-IR cells and radiosensitive CNE2 cells. Radioresistant subclone of nasopharyngeal carcinoma CNE2-IR cell line was cultured and produced according to the experienment schedule to undergo five rounds of sublethal dose of irradiation (11 Gy), and the parent cell line CNE2 cell line sensitive to radiotherapy as the control

2013-12-10 | E-GEOD-48501 | biostudies-arrayexpress

MiRNA Expression data from human radioresistant and radiosensitive Nasopharyngeal Carcinoma Cells

Project description:Most of the NPC patients suffer from local recurrences and distant metastases within 1.5 years after radiotherapy due to radioresistance. Distinct patterns of miRNa expression and signatures were found in NPC, and have been used to associate them with cell proliferation, apoptosis, invasion and metastasis, but few miRNA expression profiling studies have been focused on the tumor radioresistance.We used miRNA expression microarray analyses to identify the difference of miRNA in radioresistant NPC CNE2-IR cells and radiosensitive CNE2 cells. Radioresistant subclone of nasopharyngeal carcinoma CNE2-IR cell line was cultured and produced according to the experienment schedule to undergo five rounds of sublethal dose of irradiation (11 Gy),and the parent cell line CNE2 sensitive to radiotherapy as the control

2013-12-10 | E-GEOD-48502 | biostudies-arrayexpress

Nasopharyngeal carcinoma cell lines (expression analysis)

Project description:Three nasopharyngeal carcinoma cell lines (CNE1, CNE2, and HONE1) expression patterns against an immortalized nasopharyngeal epithelial cell line NP69.

2009-03-05 | GSE15047 | GEO

Nasopharyngeal carcinoma cell lines (copy number analysis)

2009-03-05 | GSE15051 | GEO

Genes regulated by miR-145

Project description:We used Affymetrix HG U133 Plus 2.0 GeneChips to compare the transcriptome of miR-145-overexpressing MDA-MB-231 cells against negative control miRNA precursor-transfected cells. MDA-MB-231 cells were transfected with pre-miR-145 or a negative control pre-miRNA, and subsequently total RNA was collected and processed for analysis using Affymetrix microarrays. Three independent replicates were prepared for each comparison group.

2010-09-07 | E-GEOD-19737 | biostudies-arrayexpress

Genes regulated after knock-down of Pirin in U937 cells

Project description:Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA We analyzed gene expression profiles of U937 cells after knock-down of PIR using the shPIR#7 oligonucleotides cloned in the pSICO-R lentiviral vector. No residual PIR protein is detectable in U937-shPIR#7 cells by Western blotting. U937 cells containing the empty cloning vector (U937-pSICO) were used as control. shPIR#7 oligonucleotide sequences: Human PIR#7-for: TGAAGCCACTTTGTCTTAATTTCAAGAGAATTAAGACAAAGTGGCTTCTTTTTTC Human PIR#7-rev: TCGAGAAAAAAGAAGCCACTTTGTCTTAATTCTCTTGAAATTAAGACAAAGTGGCTTCA For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.

2009-12-10 | E-GEOD-16798 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data