Genomics

Dataset Information

0

Interactions of CAF1-NOT complex components from Trypanosoma brucei


ABSTRACT: Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)

INSTRUMENT(S): Illumina HiSeq 2000

ORGANISM(S): Trypanosoma Brucei

SUBMITTER: Christine Clayton  

PROVIDER: E-MTAB-4946 | ArrayExpress | 2022-01-14

SECONDARY ACCESSION(S): ERP134347

REPOSITORIES: ArrayExpress, ENA

Dataset's files

Source:
Action DRS
E-MTAB-4946.idf.txt Idf
E-MTAB-4946.sdrf.txt Txt
Items per page:
1 - 2 of 2

Similar Datasets

2015-07-06 | E-GEOD-69585 | ArrayExpress
2015-07-06 | E-GEOD-69584 | ArrayExpress
2015-07-06 | E-GEOD-69586 | ArrayExpress
2014-12-19 | E-GEOD-64304 | ArrayExpress
2021-06-23 | PXD021899 | Pride
2012-05-05 | E-GEOD-37756 | ArrayExpress
2019-06-28 | PXD013034 | Pride
2017-05-19 | PXD006317 | Pride
2013-08-01 | E-MTAB-1648 | ArrayExpress
2011-04-01 | E-GEOD-11124 | ArrayExpress