Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

15 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ChIP-seq of Arabidopsis ARGONAUTE-small RNA interactions in Arabidopsis thaliana identified by high-throughput sequencing

ABSTRACT: The goal of this study was to identify small RNA-ARGONAUTE interactions in Arabidopsis. Co-immunoprecipitation assays followed by high-throughput sequencing were done to identify small RNA associated with HA-AGO2 and HA-AGO7. Experiment Overall Design: Sequencing-by-synthesis technology was used to sequence small RNA from input and co-immunoprecipitation fractions from cell lysates of inflorescence tissue from Arabidopsis plants transformed with HA epitope-tagged AGO2 or AGO7 constructs. Meaningful intepretation requires comparison between the input and co-immunoprecipitation datasets. Experiment Overall Design: Note: Raw data files requested, however, the submitter declined to provide them.

ORGANISM(S): Arabidopsis thaliana

SUBMITTER: James Carrington

PROVIDER: E-GEOD-12037 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Specificity of ARGONAUTE7-miR390 interaction and dual functionality in TAS3 trans-acting siRNA formation.

Montgomery Taiowa A TA Howell Miya D MD Cuperus Josh T JT Li Dawei D Hansen Jesse E JE Alexander Amanda L AL Chapman Elisabeth J EJ Fahlgren Noah N Allen Edwards E Carrington James C JC

Cell 20080313 1

Trans-acting siRNA form through a refined RNAi mechanism in plants. miRNA-guided cleavage triggers entry of precursor transcripts into an RNA-DEPENDENT RNA POLYMERASE6 pathway, and sets the register for phased tasiRNA formation by DICER-LIKE4. Here, we show that miR390-ARGONAUTE7 complexes function in distinct cleavage or noncleavage modes at two target sites in TAS3a transcripts. The AGO7 cleavage, but not the noncleavage, function could be provided by AGO1, the dominant miRNA-associated AGO, b ...[more]

PMID: 18342362

Similar Datasets

Profiling of Argonaute (AGO) 2-associated sRNAs after infection of bacterial pathogen Pseudomonas syringae

Project description:Transgenic Arabidopsis plants (AGO2::HA:AGO2) were treated with either mock (10 mM MgCl2) or Pseudomonas syringae pv. tomato (Pst) expressing avrRpt2 (R2) at a concentration of 2 x 107 cfu/ml for 14 hours. sRNAs associated with AGO1 and AGO2 were co-immunoprecipitated using antibodies against either AGO1 (AGO1-IP), or HA (hemagglutinin) (AGO2-IP). As controls, we also gel-purified the 18-28 nt fraction of the total RNAs from an AGO2 mutant (ago2-1). The co-immunoprecipitated or gel-purified RNAs were cloned and sequenced by Illumina deep sequencing. Examination of AGO-associated sRNAs in pathogen-treated or control plants

2011-05-10 | E-GEOD-26161 | biostudies-arrayexpress

Virus infection triggers widespread silencing of host genes by a distinct class of endogenous siRNAs in Arabidopsis

Project description:Virus infection triggers widespread silencing of host genes by a distinct class of endogenous siRNAs in Arabidopsis This study constructed and sequenced two independent small RNA libraries from the upper uninoculated leaves of (i) WT Arabidopsis plants 14 d after mock inoculation and of (ii) rdr1 rdr6 plants 14 d after infection with Fny CMV-Δ2b, and one library each from the upper uninoculated leaves of (iii) WT, (iv) rdr1, and (v) rdr6 plants 14 d after infection with TuMV-GFP. Coimmunoprecipitation with FLAG- and HA-specific antibodies was used to obtain (vi,vii) AGO1 and (viii,ix) AGO2 complexes, respectively, from the FLAG-AGO1/ago1-36 and HA-AGO2 plants 14 d after infection with Fny CMV-Δ2b for extracting total loaded small RNAs for the construction and sequencing of small RNA libraries.

2014-08-30 | E-GEOD-60929 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Target mRNAs induce tailing and trimming of Ago2-loaded miRNAs in neurons

Project description:We show that target mRNAs trigger the non-templated addition of nucleotides (mainly adenosines and uridines) and shortening of their cognate miRNAs in primary hippocampal neurons. The induced effect is observable both in total RNA and in Ago2-associated RNA, demonstrating that the process is initiated in Ago2 bound miRNAs. Illumina Small RNA sequencing was performed on rat hippocampal neurons infected with different target mRNAs in different conditions. The data includes 3 independent experiments: 1. Hippocampal neurons (DIV15) 6 days after transducing them with target mRNAs (driven by the Synapsin promoter) against different miRNAs. Samples are titled "Syn-Target". Samples transduced with targets containing extensive complementarity are labeled "Ext" and those with Seed complementarity are labeled "Seed". 2. Hippocampal neurons (DIV16) 7 days after transducing them with an inducible target mRNA against miR-132, and inducing for different times with Doxycycline. Samples are titled "Time-course" 3. Hippocampal neurons (DIV16) 7 days after co-transducing them with FLAG/HA-Ago2 plus an inducible target mRNA against miR-132, and inducing them for different times with Doxycycline. Samples are titled "Time-course_Ago2"

2015-03-02 | E-GEOD-57663 | biostudies-arrayexpress

ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing

Project description:The goal of this study was to identify small RNA-ARGONAUTE interactions in Arabidopsis. Co-immunoprecipitation assays followed by high-throughput sequencing were done to identify small RNA associated with HA-AGO2 and HA-AGO7. Keywords: small RNA - ARGONAUTE interactions

2008-08-16 | GSE12037 | GEO

Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.

Project description:Small RNA from total RNA (input fraction) and immunoprecipitated HA-AGO1-complexes (IP fraction) were identified using high-throughput sequencing-by-synthesis. Two replicate input fraction samples were used as controls for two replicate IP fraction samples. Total RNA from input fractions and small RNA that co-immunoprecipitated with HA-AGO1 complexes were size fractionated by polyacrylamide gel electrophoresis to recover 18-24 nucleotide small RNA. 3' and then 5' adaptors were serially ligated on to each small RNA followed by PAGE purification. RT-PCR was used to convert RNA to DNA amplicons. Amplicons were sequenced using the Illumina GAIIx platform. Resulting reads were parsed and mapped to the A. thaliana genome (TAIR9) using the CASHX pipeline.

2010-06-21 | E-GEOD-22252 | biostudies-arrayexpress

Profiling of direct mRNA targets of miR-130a, miR-203 and miR-205 in prostate cancer cell line LNCaP

Project description:Micro RNAs (miRNAs) miR-130a, miR-203 and miR-205 are jointly downregulated in prostate cancer and act as repressors of AR-signaling. MiRNAs are small non-coding RNAs that regulate the expression of specific mRNA targets mainly by translational repression, mRNA deadenylation or cleavage. Reconstitution of these lost miRNAs in the LNCaP PCa cell line cause morphology changes, growth arrest, and apoptosis, increasing when the miRNAs were co-expressed. This series identifies direct targets of miR-130a, miR-203, and miR-205 by AGO2-RNA co-immunoprecipitation as described by (Beitzinger et al. 2007) upon miRNA reconstitution in LNCaP cells and analyzing AGO2-bound mRNAs using Affymetrix Genechips. Relative levels of AGO2 bound versus total RNA expression were compared between miRNA reconstituted and miR-scr transfected samples. Three arrays each for AGO2-bound RNA upon reconstitution of miR-130a, miR-203, miR-205, a scramble miRNA, and three arrays each for total RNA upon reconstitution of miR-130a, miR-203, miR-205, a scramble miRNA.

2012-03-08 | E-GEOD-22979 | biostudies-arrayexpress

Human gastric cancer cells SGC7901-NM RIP-Chip result: has-miR-625 lentivirus infected vs. control

Project description:Transcriptional profiling of RIP products of human gastric cancer cells SGC7901-NM comparing control with SGC7901-NM infected with has-miR-625 lentivirus Stable transfected cell lines, SGC7901-NM-has-miR-625 vs. SGC7901-NM-NC, after RNA-binding protein immunoprecipitation with Ago2 antibody, the experimental group (Ago2) vs. the control group (input) per array.

2012-06-19 | E-GEOD-38811 | biostudies-arrayexpress

Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing

Project description:Background: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequenced long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. Results: Analysis of these data sets revealed that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently catalogued. We further found that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs revealed that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. Conclusions: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon. PAR-CLIP profiling for snoRNP core proteins NOP56, NOP58, Fibrillarin, and Dyskerin in HEK293 cells. Small RNA profiling using RNA-seq in HEK293 and HeLa cells, small RNA profiling using IP-seq of Ago2 associated small RNAs.

2013-05-08 | E-GEOD-43666 | biostudies-arrayexpress

A nuclear role for the Argonaute protein AGO2 in mammalian gametogenesis

Project description:The reduced sperm count observed in Ago2 cKO mice implies that AGO2 has non-redundant functions in the male germ line. Because AGO2 is a key protein in the RNA interference (RNAi) pathway, we first postulated that AGO2 loss disrupts normal transcriptional and translational dynamics of target mRNAs relevant to sperm maturation. To address this hypothesis, we took advantage of the apparently normal spermatogenesis in Ago2 cKO mice, which allowed us to purify matched meiotic and post-meiotic germ cells from Ago2 cKO and wild type controls. We examined changes in the transcriptome and proteome of these two spermatogenic stages in Ago2 cKO relative to control mice using RNA-seq and quantitative mass spectrometry (MS). To further examine if the changes in mRNA and protein levels detected in Ago2 cKO germ cells was due to a loss of regulation by the canonical AGO2-miRNA pathway, we characterized AGO2 protein interactors by AGO2 immunoprecipitation-mass spectrometry (IP-MS) in cytoplasmic and nuclear fractions of post-meiotic cells

2022-08-01 | PXD027935 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data