Project description:Background: Metastases to the brain from breast cancer have a high mortality. Basal-like and HER2 positive breast cancers appear to have a high propensity to spread to the brain. The mechanisms that allow cells to colonise the brain are unclear. Methods: We have analysed matched and unpaired samples of breast cancer and brain metastases using morphology, immunophenotype and expression profiling and validated the data using in vitro cell culturing models and in vivo mice model. Results: Most of the brain metastases were triple negative and had a basal-like phenotype. Metastatic cells to the brain over-expressed HER3 compared to primaries and showed evidence of higher activation of the MAPK pathways. Inhibition using anti-neuregulin antibody, Herceptin and Lapatinib reduced tumour growth in vitro and in vivo. Conclusions: The data demonstrate activation of neuregulin-HER3 pathway in brain metastases from breast cancer and suggest that even in absence of HER2 amplification (as with triple negative and basal cancers), anti-epidermal growth factor receptor family inhibitors may have a role in treating these patients An initial set of 29 matched pairs of primary breast cancer and their brain metastases and 22 unmatched brain metastases of from breast cancer was were available as formalin fixed-paraffin embedded (FFPE) tumor blocks. A second set of validation samples comprisinged of 10 matched pairs of primary breast cancer and their corresponding brain metastases and a further 11 non-breast metastatic brain cancers tumours fromn non-breast sites (one melanoma, six lung adenocarcinomas, one prostate carcinoma, one colon carcinoma and two renal cell carcinomas was also studied. After filtering DASL data on the first set of samples, 15/29 matched pairs and 22/22 unmatched metastases remained available for analysis for the initial set. In the second set all samples were analysed. RNA extraction and Real-Time RT-PCR Three 5Î¼m thick FFPE sections of clinical samples, parental cell line MB-MDA-231 cell line (fixed in paraformoldehyde and embedded in paraffin) and intracranial mouse tumours were cut and de-waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA Paraffin KitÂ® (Roche Applied Science, Mannheim, Germany) according to the manufacturerâs protocol. RNA was quantified using the NanoDropÂ® ND-1000 (NanoDrop Technologies, DE, USA). RT-PCR for HER3 and housekeeping genes GAPDH and RPL13a was carried out using the Rotor-gene system (Corbett Life Science, Australia). Complementary DNA (cDNA) was synthesized from 240ng of total RNA using oligodT16 primers and the SuperScriptTM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). A standard curve for gene expression of HER3 and GAPDH and RPL13a was constructed using total RNA from a human breast cancer cell line (SKBR-3). Replicates of 10-fold dilutions of RNA in water were made to give 3 different calibrators, each with a known amount of SKBR-3 RNA for which arbitrary copy number were given. The PCR conditions were: 50Â°C for 2 minutes, 95Â°C for 2 minutes, followed by 40 cycles with the following profile: denaturation at 95Â°C for 20 seconds, annealing at 60Â°C for 15 seconds, extension at 72Â°C for 20 seconds. Flourescent incorporation was acquired in the green channel during the 72Â°C incubations. Intron spanning primer sequences were: GAPDH (5âCTGCACCACCAACTGCTTAG3â, 5âGTCTTCTGGGTGGCA GTGAT3â), RPL13a (5âGTTGGTGTTCATCCGTTG3â, 5âGTACGCTGTGAAGCATCAA3â), HER3 (5âTGGTTCATGGGCATGTATCC3â, 5âCTAGACCTAAGACTTGGAGC3â). DASL gene expression profilingGene expression profiling was performed using the DASL assay (cDNA-mediated annealing, selection extension and ligation, Illumina Inc., California, USA) interrogating the DASL Cancer Panel that contained 512 cancer related genes. The first and second sets of samples were analyzed in two independent experiments. Tumours arising from the animal experiment were analyzed in conjunction with the second set of clinical samples. All protocols were as specified by Illumina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo-d(T)18 and random nonamers. Oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylated cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non-hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. These products were subjected to PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted using BeadStudio software (Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Probes with a BeadStudio detection score greater than 0.99 in more than 15 conditions were included. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in GenespringÂ® version 7.0 software (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using: Similarity measure; Pearson Correlation and clustering algorithm; Average Linkage. Genes differentially expressed between primary tumors and brain metastases were identified using analysis of variance (ANOVA, p<0.01) or parametric test, variances not assumed equal (Welch t-test, p < 0.005). Up and down regulation was considered for normalized data values that were greater or less than a factor of 2 fold for the conditions compared.

Project description:Background: Metastases to the brain from breast cancer have a high mortality. Basal-like and HER2 positive breast cancers appear to have a high propensity to spread to the brain. The mechanisms that allow cells to colonise the brain are unclear. Methods: We have analysed matched and unpaired samples of breast cancer and brain metastases using morphology, immunophenotype and expression profiling and validated the data using in vitro cell culturing models and in vivo mice model. Results: Most of the brain metastases were triple negative and had a basal-like phenotype. Metastatic cells to the brain over-expressed HER3 compared to primaries and showed evidence of higher activation of the MAPK pathways. Inhibition using anti-neuregulin antibody, Herceptin and Lapatinib reduced tumour growth in vitro and in vivo. Conclusions: The data demonstrate activation of neuregulin-HER3 pathway in brain metastases from breast cancer and suggest that even in absence of HER2 amplification (as with triple negative and basal cancers), anti-epidermal growth factor receptor family inhibitors may have a role in treating these patients. An initial set of 29 matched pairs of primary breast cancer and their brain metastases and 22 unmatched brain metastases of from breast cancer was were available as formalin fixed-paraffin embedded (FFPE) tumor blocks. A second set of validation samples comprisinged of 10 matched pairs of primary breast cancer and their corresponding brain metastases and a further 11 non-breast metastatic brain cancers tumours fromn non-breast sites (one melanoma, six lung adenocarcinomas, one prostate carcinoma, one colon carcinoma and two renal cell carcinomas was also studied. After filtering DASL data on the first set of samples, 15/29 matched pairs and 22/22 unmatched metastases remained available for analysis for the initial set. In the second set all samples were analysed. RNA extraction and Real-Time RT-PCR Three 5Î¼m thick FFPE sections of clinical samples, parental cell line MB-MDA-231 cell line (fixed in paraformoldehyde and embedded in paraffin) and intracranial mouse tumours were cut and de-waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA Paraffin KitÂ® (Roche Applied Science, Mannheim, Germany) according to the manufacturerâs protocol. RNA was quantified using the NanoDropÂ® ND-1000 (NanoDrop Technologies, DE, USA). RT-PCR for HER3 and housekeeping genes GAPDH and RPL13a was carried out using the Rotor-gene system (Corbett Life Science, Australia). Complementary DNA (cDNA) was synthesized from 240ng of total RNA using oligodT16 primers and the SuperScriptTM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). A standard curve for gene expression of HER3 and GAPDH and RPL13a was constructed using total RNA from a human breast cancer cell line (SKBR-3). Replicates of 10-fold dilutions of RNA in water were made to give 3 different calibrators, each with a known amount of SKBR-3 RNA for which arbitrary copy number were given. The PCR conditions were: 50Â°C for 2 minutes, 95Â°C for 2 minutes, followed by 40 cycles with the following profile: denaturation at 95Â°C for 20 seconds, annealing at 60Â°C for 15 seconds, extension at 72Â°C for 20 seconds. Flourescent incorporation was acquired in the green channel during the 72Â°C incubations. Intron spanning primer sequences were: GAPDH (5âCTGCACCACCAACTGCTTAG3â, 5âGTCTTCTGGGTGGCA GTGAT3â), RPL13a (5âGTTGGTGTTCATCCGTTG3â, 5âGTACGCTGTGAAGCATCAA3â), HER3 (5âTGGTTCATGGGCATGTATCC3â, 5âCTAGACCTAAGACTTGGAGC3â). DASL gene expression profilingGene expression profiling was performed using the DASL assay (cDNA-mediated annealing, selection extension and ligation, Illumina Inc., California, USA) interrogating the DASL Cancer Panel that contained 512 cancer related genes. The first and second sets of samples were analyzed in two independent experiments. Tumours arising from the animal experiment were analyzed in conjunction with the second set of clinical samples. All protocols were as specified by Illumina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo-d(T)18 and random nonamers. Oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylated cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non-hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. These products were subjected to PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted using BeadStudio software (Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Probes with a BeadStudio detection score greater than 0.99 in more than 15 conditions were included. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in GenespringÂ® version 7.0 software (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using: Similarity measure; Pearson Correlation and clustering algorithm; Average Linkage. Genes differentially expressed between primary tumors and brain metastases were identified using analysis of variance (ANOVA, p<0.01) or parametric test, variances not assumed equal (Welch t-test, p < 0.005). Up and down regulation was considered for normalized data values that were greater or less than a factor of 2 fold for the conditions compared.

Project description:Comparison of gene expression profiles between a primary melanoma and an early metastatic specimen from the same patient will provide essential biological insight into early metastatic processes. The DASL (cDNA mediated annealing, selection, extension and ligation) assay has been used to generate gene expression data for 502 cancer-related genes from very small formalin-fixed sentinel node biopsy (SNB) melanoma samples, this data has been further compared with gene expression of the matched formalin-fixed primary melanoma. Tissue was sampled from twenty-five SNB deposits using laser capture microdissection. The mean number of genes detected using DASL with SNB samples was lower than when using a core of primary melanoma tumor (242 versus 434 genes). A large proportion of SNB samples failed (<240 genes detected) the assay (57.7%). Area of tissue microdissected, RNA concentration and qRT-PCR quality control did not predict performance of samples on the array but age of sampled tissue negatively correlated with number of genes detected (p=0.01). For samples that performed successfully, matched primary samples were available for 10 samples. Gene expression profiles correlated between all matched tumor pairs (Spearman’s rho 0.15-0.80, p<0.01), although a number of genes were differentially expressed between nodal and primary tumors in all tumor pairs. This study demonstrates that the DASL assay can be used to generate gene expression data from small formalin-fixed samples, but not consistently. Differentially expressed genes were identified across 10 matched primary and nodal tumor pairs suggesting that the DASL assay could be used to derive essential biological information about early metastasis. Formalin-fixed paraffin-embedded SNB samples and primary tumors were identified from two study sets. In Study 1, population ascertained melanoma patients were recruited to a cohort in the period from 2000 till the present day. Eight positive SNB samples were identified, from patients whose primary tumors had already been sampled for DASL studies. In Study 2, seventeen positive SNB samples were identified in a study designed to identify predictors of sentinel node positivity and relapse (SNB study). One nodal RNA sample, microdissected from a diagnostic H&E slide, was not sent for DASL analysis because of low RNA concentration (0.37 ng/μl), therefore a total of 26 nodal samples (including 2 replicate samples) were supplied to the Illumina DASL service provider. Of the 11 samples successfully yielding gene expression data, 10 had matched primary samples (e.g., Node_1 and Primary_1) for which gene expression data were available and is presented in this data set.

Project description:In recent years, the use of FFPE tissue in gene expression microarray (GEM) studies has become a topic of increased interest, because pathology departments worldwide contain an invaluable source of biological disease-specific FFPE- tissue material. Thus far, some published studies on FFPE tissue consider the processed tissue amenable, whereas other studies assert that the tissue is not useful in GEM. In general, pancreatic tissue is known to contain large amounts of nucleases, leading to high turnover rates and degradation of RNA in the tissue. This characteristic, in combination with FFPE processing time and its effect on the tissue, does not make FFPE pancreatic tissue the obvious choice for GEM. The basis for using FFPE pancreatic tissue in RNA-based assays seems suboptimal. Previous GEM studies have used different FFPE tissue types, but GEM studies on FFPE pancreatic tissue have not been published. In most studies, the tissue was specially processed for use with GEMs. Here we demonstrate the usefulness of randomly archived FFPE pancreatic tissues for GEMs. For this purpose we included FFPE pancreatic tissue from patients with congenital hyperinsulinism or insulinoma; In these patients, pancreas resection is performed when medical treatment is not adequate to prevent hyperinsulinemic hypoglycemia or when patients do not respond to medical treatment. Although ribonuclease-rich, we obtained biologically relevant and disease-specific, significant genes; cancer-related genes and genes involved in a) the regulation of insulin secretion and synthesis, b) amino acid metabolism, and c) calcium ion homeostasis. This application may extend the possibilities of gene expression studies to many tissue types, especially in rare diseases, for which fresh frozen tissue is not readily available. A total of 15 samples were included in this study using a 58K chip. 29,134 human 60mer oligonucleotide targets were arrayed on the chips in duplicates. Each chip is hybridized with sample material (labelled with Cy5) from one patient and reference material (labelled with Cy3). Reference material contains pooled RNA from four different cancer cell lines; HeLa (cervical epithelium), SK-BR-3 (mammary gland), HT29 (colon) and A431 (skin) cells. Seven patients with congenital hyperinsulinism (five FFPE and two frozen samples), one patient with insulinoma and five controls were included in the study. Inclusion criteria for controls was that their cause of death was not pancreas-related. Samples were obtained from archived FFPE pancreatic material. The insulinoma sample was included in the study, because the biopsy was originally divided with one part being frozen and the other part being routinely formalin-fixed and paraffin-embedded. In the study we therefore include a frozen insulinoma sample and a FFPE insulinoma sample that was processed in duplicate.

Dataset Information

Metastatic breast cancer to the brain: implications of the local microenvironment for colonization and treatment

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets