Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
SUBMITTER: James Carrington
PROVIDER: E-GEOD-14694 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Publications
Computational and analytical framework for small RNA profiling by high-throughput sequencing.
Fahlgren Noah N Sullivan Christopher M CM Kasschau Kristin D KD Chapman Elisabeth J EJ Cumbie Jason S JS Montgomery Taiowa A TA Gilbert Sunny D SD Dasenko Mark M Backman Tyler W H TW Givan Scott A SA Carrington James C JC
RNA (New York, N.Y.) 20090323 5
The advent of high-throughput sequencing (HTS) methods has enabled direct approaches to quantitatively profile small RNA populations. However, these methods have been limited by several factors, including representational artifacts and lack of established statistical methods of analysis. Furthermore, massive HTS data sets present new problems related to data processing and mapping to a reference genome. Here, we show that cluster-based sequencing-by-synthesis technology is highly reproducible as ...[more]
Similar Datasets
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS).
2009-06-03 | GSE14694 | GEO
Project description:This SuperSeries is composed of the following subset Series: GSE14694: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) GSE14695: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards) Refer to individual Series
2009-06-02 | E-GEOD-14696 | biostudies-arrayexpress
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.
2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress
Project description:Human Umbilical Vein Endothelial Cells were treated with three newly synthesized compounds and DMSO as vehicle. Total RNA was isolated 6 and 24h after treatment and gene expression analysis was performed. Three independent experiments were performed, corresponding to rep1, rep2 and rep3. Experiment 1 (rep1) contained all substances at both time points tested. Experiment 2 (rep2) contained two of the compounds and control DMSO at both time points. Experiment 3 (rep3) contained the third compound and control DMSO at both time points.
2016-06-30 | GSE75588 | GEO
Project description:The fungal pathogen Sclerotinia sclerotiorum infects a broad range of dicotyledonous plant species and is the causative agent of stem rot in Brassica napus. To elucidate the mechanisms underlying the defense response, we studied the patterns of gene expression in a partially resistant variety of ZhongYou 821 (ZY821) and a susceptible line from Westar over five time points, 6, 12, 24, 48, and 72 hours post-inoculation (hpi) using a B. napus oligonucleotide microarray. Maximum differential gene expression was observed at 48 hpi in both genotypes with ZY821 responding more quickly than Westar. Specific sets of genes exhibited higher levels of expression at the earlier stages of the infection (6-12 hpi), including genes encoding defense-associated proteins such as chitinases, glucanases, osmotins and lectins and genes encoding transcription factors belonging to the zinc finger, WRKY, AP2, and MYB classes. Genes encoding enzymes involved in JA, ethylene, and auxin synthesis were induced in both genotypes, as were those for gibberellin degradation. Changes in metabolic pathways affecting carbohydrate and energy metabolism appeared to be directed toward shuttling carbon reserves to the TCA cycle. Genes involved in glucosinolate and phenylpropanoid biosynthesis were highly up-regulated suggesting that secondary metabolites are also important components of the response to S. sclerotiorum in B. napus. Keywords: Time course, infected vs mock infected Time course experiment (6hr, 12 hr, 24 hr, 48 hr, 72 hrs), sclerotinia infected vs mock-infected. Biological replicates: 3, independently harvested. Technical replicates: 2, dye swapped within each time for each biological replicate (total 6 slides per time point) time after innoculation: 6 hours: zy 6h inf vs control rep1, zy 6h control vs inf rep1, zy 6h inf vs control rep2, zy 6h control vs inf rep2, zy 6h inf vs control rep3, zy 6h control vs inf rep3 time after innoculation: 12 hours: zy 12h inf vs control rep1, zy 12h control vs inf rep1, zy 12h inf vs control rep2, zy 12h control vs inf rep2, zy 12h inf vs control rep3, zy 12h control vs inf rep3 time after innoculation: 24 hours: zy 24h inf vs control rep1, zy 24h control vs inf rep1, zy 24h inf vs control rep2, zy 24h control vs inf rep2, zy 24h inf vs control rep3, zy 24h control vs inf rep3 time after innoculation: 48 hours: zy 48h inf vs control rep1, zy 48h control vs inf rep1, zy 48h inf vs control rep2, zy 48h control vs inf rep2, zy 48h inf vs control rep3, zy 48h control vs inf rep3 time after innoculation: 72 hours: zy 72h inf vs control rep1, zy 72h control vs inf rep1, zy 72h inf vs control rep2, zy 72h control vs inf rep2, zy 72h inf vs control rep3, zy 72h control vs inf rep3 biological replicate: zy 6h inf vs control rep1, zy 6h inf vs control rep2, zy 6h inf vs control rep3 biological replicate: zy 6h control vs inf rep1, zy 6h control vs inf rep2, zy 6h control vs inf rep3 technical replicate - labeled-extract: zy 6h inf vs control rep1, zy 6h control vs inf rep1 technical replicate - labeled-extract: zy 6h inf vs control rep2, zy 6h control vs inf rep2 technical replicate - labeled-extract: zy 6h inf vs control rep3, zy 6h control vs inf rep3 biological replicate: zy 12h inf vs control rep1, zy 12h inf vs control rep2, zy 12h inf vs control rep3 biological replicate: zy 12h control vs inf rep1, zy 12h control vs inf rep2, zy 12h control vs inf rep3 technical replicate - labeled-extract: zy 12h inf vs control rep1, zy 12h control vs inf rep1 technical replicate - labeled-extract: zy 12h inf vs control rep2, zy 12h control vs inf rep2 technical replicate - labeled-extract: zy 12h inf vs control rep3, zy 12h control vs inf rep3 biological replicate: zy 24h inf vs control rep1, zy 24h inf vs control rep2, zy 24h inf vs control rep3 biological replicate: zy 24h control vs inf rep1, zy 24h control vs inf rep2, zy 24h control vs inf rep3 technical replicate - labeled-extract: zy 24h inf vs control rep1, zy 24h control vs inf rep1 technical replicate - labeled-extract: zy 24h inf vs control rep2, zy 24h control vs inf rep2 technical replicate - labeled-extract: zy 24h inf vs control rep3, zy 24h control vs inf rep3 biological replicate: zy 48h inf vs control rep1, zy 48h inf vs control rep2, zy 48h inf vs control rep3 biological replicate: zy 48h control vs inf rep1, zy 48h control vs inf rep2, zy 48h control vs inf rep3 technical replicate - labeled-extract: zy 48h inf vs control rep1, zy 48h control vs inf rep1 technical replicate - labeled-extract: zy 48h inf vs control rep2, zy 48h control vs inf rep2 technical replicate - labeled-extract: zy 48h inf vs control rep3, zy 48h control vs inf rep3 biological replicate: zy 72h inf vs control rep1, zy 72h inf vs control rep2, zy 72h inf vs control rep3 biological replicate: zy 72h control vs inf rep1, zy 72h control vs inf rep2, zy 72h control vs inf rep3 technical replicate - labeled-extract: zy 72h inf vs control rep1, zy 72h control vs inf rep1 technical replicate - labeled-extract: zy 72h inf vs control rep2, zy 72h control vs inf rep2 technical replicate - labeled-extract: zy 72h inf vs control rep3, zy 72h control vs inf rep3
2010-05-06 | E-GEOD-13256 | biostudies-arrayexpress
Project description:The fungal pathogen Sclerotinia sclerotiorum infects a broad range of dicotyledonous plant species and is the causative agent of stem rot in Brassica napus. To elucidate the mechanisms underlying the defense response, we studied the patterns of gene expression in a partially resistant variety of ZhongYou 821 (ZY821) and a susceptible line from Westar over five time points, 6, 12, 24, 48, and 72 hours post-inoculation (hpi) using a B. napus oligonucleotide microarray. Maximum differential gene expression was observed at 48 hpi in both genotypes with ZY821 responding more quickly than Westar. Specific sets of genes exhibited higher levels of expression at the earlier stages of the infection (6-12 hpi), including genes encoding defense-associated proteins such as chitinases, glucanases, osmotins and lectins and genes encoding transcription factors belonging to the zinc finger, WRKY, AP2, and MYB classes. Genes encoding enzymes involved in JA, ethylene, and auxin synthesis were induced in both genotypes, as were those for gibberellin degradation. Changes in metabolic pathways affecting carbohydrate and energy metabolism appeared to be directed toward shuttling carbon reserves to the TCA cycle. Genes involved in glucosinolate and phenylpropanoid biosynthesis were highly up-regulated suggesting that secondary metabolites are also important components of the response to S. sclerotiorum in B. napus. Keywords: Time course, and infected vs mock infected Time course experiment (6hr, 12 hr, 24 hr, 48 hr, 72 hrs), sclerotinia infected vs mock-infected. Biological replicates: 3, independently harvested. Technical replicates: 2, dye swapped within each time for each biological replicate (total 6 slides per time point) time after innoculation: 6 hours: westar 6h inf vs control rep1, westar 6h control vs inf rep1, westar 6h inf vs control rep2, westar 6h control vs inf rep2, westar 6h inf vs control rep3, westar 6h control vs inf rep3 time after innoculation: 12 hours: westar 12h inf vs control rep1, westar 12h control vs inf rep1, westar 12h inf vs control rep2, westar 12h control vs inf rep2, westar 12h inf vs control rep3, westar 12h control vs inf rep3 time after innoculation: 24 hours: westar 24h inf vs control rep1, westar 24h control vs inf rep1, westar 24h inf vs control rep2, westar 24h control vs inf rep2, westar 24h inf vs control rep3, westar 24h control vs inf rep3 time after innoculation: 48 hours: westar 48h inf vs control rep1, westar 48h control vs inf rep1, westar 48h inf vs control rep2, westar 48h control vs inf rep2, westar 48h inf vs control rep3, westar 48h control vs inf rep3 time after innoculation: 72 hours: westar 72h inf vs control rep1, westar 72h control vs inf rep1, westar 72h inf vs control rep2, westar 72h control vs inf rep2, westar 72h inf vs control rep3, westar 72h control vs inf rep3 biological replicate: westar 6h inf vs control rep1, westar 6h inf vs control rep2, westar 6h inf vs control rep3 biological replicate: westar 6h control vs inf rep1, westar 6h control vs inf rep2, westar 6h control vs inf rep3 technical replicate - labeled-extract: westar 6h inf vs control rep1, westar 6h control vs inf rep1 technical replicate - labeled-extract: westar 6h inf vs control rep2, westar 6h control vs inf rep2 technical replicate - labeled-extract: westar 6h inf vs control rep3, westar 6h control vs inf rep3 biological replicate: westar 12h inf vs control rep1, westar 12h inf vs control rep2, westar 12h inf vs control rep3 biological replicate: westar 12h control vs inf rep1, westar 12h control vs inf rep2, westar 12h control vs inf rep3 technical replicate - labeled-extract: westar 12h inf vs control rep1, westar 12h control vs inf rep1 technical replicate - labeled-extract: westar 12h inf vs control rep2, westar 12h control vs inf rep2 technical replicate - labeled-extract: westar 12h inf vs control rep3, westar 12h control vs inf rep3 biological replicate: westar 24h inf vs control rep1, westar 24h inf vs control rep2, westar 24h inf vs control rep3 biological replicate: westar 24h control vs inf rep1, westar 24h control vs inf rep2, westar 24h control vs inf rep3 technical replicate - labeled-extract: westar 24h inf vs control rep1, westar 24h control vs inf rep1 technical replicate - labeled-extract: westar 24h inf vs control rep2, westar 24h control vs inf rep2 technical replicate - labeled-extract: westar 24h inf vs control rep3, westar 24h control vs inf rep3 biological replicate: westar 48h inf vs control rep1, westar 48h inf vs control rep2, westar 48h inf vs control rep3 biological replicate: westar 48h control vs inf rep1, westar 48h control vs inf rep2, westar 48h control vs inf rep3 technical replicate - labeled-extract: westar 48h inf vs control rep1, westar 48h control vs inf rep1 technical replicate - labeled-extract: westar 48h inf vs control rep2, westar 48h control vs inf rep2 technical replicate - labeled-extract: westar 48h inf vs control rep3, westar 48h control vs inf rep3 biological replicate: westar 72h inf vs control rep1, westar 72h inf vs control rep2, westar 72h inf vs control rep3 biological replicate: westar 72h control vs inf rep1, westar 72h control vs inf rep2, westar 72h control vs inf rep3 technical replicate - labeled-extract: westar 72h inf vs control rep1, westar 72h control vs inf rep1 technical replicate - labeled-extract: westar 72h inf vs control rep2, westar 72h control vs inf rep2 technical replicate - labeled-extract: westar 72h inf vs control rep3, westar 72h control vs inf rep3
2009-01-31 | E-GEOD-13254 | biostudies-arrayexpress
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards.
2009-06-03 | GSE14695 | GEO
Project description:Chromatin organization must be maintained during cell proliferation to preserve cellular identity and genome integrity. However, DNA replication results in transient displacement of DNA bound proteins, and it is unclear how they regain access to newly replicated DNA. Using quantitative MS-based proteomics coupled to Nascent Chromatin Capture, we provide time resolved binding kinetics for thousands of proteins behind replisomes within euchromatin and heterochromatin in human cells. This shows that most proteins regain access within the first 15 minutes after the passage of the fork. In contrast, 30% of the identified proteins do not, and this delay cannot be inferred from their known function, physicochemical properties, or nuclear abundance. Instead, differential chromatin organization affect their reassociation. We provide evidence that DNA replication not only disrupts but also promotes recruitment of transcription factors and chromatin remodellers, providing a significant advance in understanding how DNA replication could contribute to programmed changes of cell memory.We include here a reference to link the data with our manuscript:Tables SUPP1 and SUPP2:NCC data: PT7988 (Bio-rep1), PT8242 (Bio-rep2), PT8243 (Bio-rep3). 1-24 (24 high-pH RPLC fractions from TMT labeled peptides)Nuclear fraction data: PT7988 (Bio-rep1), PT8242 (Bio-rep2), PT8243 (Bio-rep3). 25-48 (24 high-pH RPLC fractions from TMT labeled peptides)Tables SUPP3-5:NCC data: PT9825 (Bio-rep1), PT9825 (Bio-rep2), PT9825 (Bio-rep3). (11-34, 35-58, 59-82) (24 high-pH RPLC fractions from TMT labeled peptides)Nuclear fraction data: PT9825 (Bio-rep1), PT9825 (Bio-rep2), PT9825 (Bio-rep3). (83-106, 107-130, 131-154). (24 high-pH RPLC fractions from TMT labeled peptides)
2023-02-02 | PXD035489 | Pride
Project description:Developmental competences of oocytes derived from prepubertal heifers are lower than those derived from adult counterparts. The objective of this study was to identify a range of genes associated with reduced oocyte competence that are differentially expressed between adult versus prepubertal donors. Microarray experiments were conducted using total RNA isolated from GV and MII stages oocytes collected from adult and prepubertal animals using Affymetrix GeneChip Bovine Genome Array containing 24,072 probe sets representing over 23,000 transcripts. A total of 549 and 333 genes were differentially expressed between prepubertal versus adult bovine MII and GV stages oocytes respectively. Out of these, 312 and 176 genes were up-regulated, while 237 and 157 were down-regulated in prepubertal when compared with adult MII and GV oocytes respectively. Ontological classification of the differentially expressed genes revealed that up-regulated genes in adult oocytes were involved in signal transduction, regulation of transcription DNA-dependent, and transport. Results from the present study indicated that significant number of genes were differentially expressed (>2-fold, p<0.01) between the two groups. Thus the decreased developmental competence of oocytes from prepubertal heifers may be induced due to difference in gene expression abundance as observed in our study. In conclusion, transcript abundance analyses of oocytes using microarray approach have been carried out in bovine and several other species. However, to our knowledge, this is the first study carried out to examine genes expression differential abundance in oocytes derived from perpubertal versus adult Japanese Black Cattle. Bovine 4b PP biological rep1, Bovine 78b PP biological rep2, Bovine 79 PP biological rep3 represents GV stage oocytes derived from Prepubertal (PP) heifer group, while Bovine 74b A biological rep1, Bovine 80b A biological rep2, Bovine 81 A biological rep3 represents GV stage oocytes derived from Adult (A) cow group. Bovine 7 PP biological rep1, Bovine 53 PP biological rep2, Bovine 57 PP biological rep3 represents MII stage oocytes derived from Prepubertal heifer group, while Bovine 59 A biological rep1, Bovine 70 A biological rep2, Bovine 71 A biological rep3 represents MII stage oocytes from Adult cow group.
2012-06-01 | GSE24477 | GEO
Project description:Human Umbilical Vein Endothelial Cells were treated with three newly synthesized compounds and DMSO as vehicle. Total RNA was isolated 6 and 24h after treatment and gene expression analysis was performed. Three independent experiments were performed, corresponding to rep1, rep2 and rep3. Experiment 1 (rep1) contained all substances at both time points tested. Experiment 2 (rep2) contained two of the compounds and control DMSO at both time points. Experiment 3 (rep3) contained the third compound and control DMSO at both time points. 18 samples were analyzed
2016-06-30 | E-GEOD-75588 | biostudies-arrayexpress