Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)


ABSTRACT: The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

ORGANISM(S): Arabidopsis thaliana

SUBMITTER: James Carrington 

PROVIDER: E-GEOD-14695 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

altmetric image

Publications


The advent of high-throughput sequencing (HTS) methods has enabled direct approaches to quantitatively profile small RNA populations. However, these methods have been limited by several factors, including representational artifacts and lack of established statistical methods of analysis. Furthermore, massive HTS data sets present new problems related to data processing and mapping to a reference genome. Here, we show that cluster-based sequencing-by-synthesis technology is highly reproducible as  ...[more]

Similar Datasets

2009-06-03 | GSE14695 | GEO
2009-06-02 | E-GEOD-14696 | biostudies-arrayexpress
2009-06-02 | E-GEOD-14694 | biostudies-arrayexpress
2012-03-03 | GSE36217 | GEO
2012-03-03 | E-GEOD-36217 | biostudies-arrayexpress
| PRJNA324163 | ENA
| PRJNA153117 | ENA
| PRJNA321434 | ENA
2013-04-23 | E-GEOD-33120 | biostudies-arrayexpress
| PRJNA448331 | ENA