Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

ABSTRACT: The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

ORGANISM(S): Arabidopsis thaliana

SUBMITTER: James Carrington 

PROVIDER: E-GEOD-14695 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress