Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

14 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

ABSTRACT: This SuperSeries is composed of the following subset Series: GSE14694: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) GSE14695: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards) Refer to individual Series

ORGANISM(S): Arabidopsis thaliana

SUBMITTER: James Carrington

PROVIDER: E-GEOD-14696 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Computational and analytical framework for small RNA profiling by high-throughput sequencing.

Fahlgren Noah N Sullivan Christopher M CM Kasschau Kristin D KD Chapman Elisabeth J EJ Cumbie Jason S JS Montgomery Taiowa A TA Gilbert Sunny D SD Dasenko Mark M Backman Tyler W H TW Givan Scott A SA Carrington James C JC

RNA (New York, N.Y.) 20090323 5

The advent of high-throughput sequencing (HTS) methods has enabled direct approaches to quantitatively profile small RNA populations. However, these methods have been limited by several factors, including representational artifacts and lack of established statistical methods of analysis. Furthermore, massive HTS data sets present new problems related to data processing and mapping to a reference genome. Here, we show that cluster-based sequencing-by-synthesis technology is highly reproducible as ...[more]

PMID: 19307293

Similar Datasets

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS). We analyzed the reproducibility of small RNA SBS datasets by comparing libraries generated for biological replicates (rep1 and rep2) and technical replicates (rep2 and rep3).

2009-06-02 | E-GEOD-14694 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

2009-06-03 | GSE14695 | GEO

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

2009-06-03 | GSE14694 | GEO

Project description:Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

| PRJNA112327 | ENA

Arabidopsis thaliana

Project description:Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

| PRJNA114413 | ENA

Arabidopsis thaliana

Project description:Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

| PRJNA114411 | ENA

SPaRTAN, a computational framework for linking cell-surface receptors to transcriptional regulators

Project description:SPaRTAN, a computational framework for linking cell-surface receptors to transcriptional regulators

| PRJNA722248 | ENA

Identification of transcription factors dictating blood cell development using a bidirectional transcription network-based computational framework [RNAseq_THP1_GSK-LSD1]

Project description:Genome-wide transcription factor binding profiles provide valuable insights into hematopoietic development and malignancies. Today, advanced computational methods exploit cis-regulatory information to predict complex gene regulatory networks controlled by transcription factors. However, these prediction methods still require large amounts of reference data or experimental expertise. Here, we present a low-requirement network-based computational framework that exploits bidirectional transcription marked regulatory elements to identify important transcription factors driving hematopoietic decision making. Using CAGE-seq we predicted TF binding and confirmed experimentally validated TF important in cell conversion strategies by exploiting bidirectional regions. Next, we applied our framework to predict driving transcription factors in induced normal erythropoiesis and early myelopoiesis, as well as in acute myeloid leukemia associated MLL-AF9-driven immortalisation. Our approach allowed the identification of experimentally validated as well as thus far unexplored transcription factors in these processes.

2022-11-09 | GSE204710 | GEO