Global Changes following N-deprivation in Chlamydomonas
Ontology highlight
ABSTRACT:
ORGANISM(S): Chlamydomonas reinhardtii
SUBMITTER: Guangxi Wu
PROVIDER: E-GEOD-24367 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Publications
Changes in transcript abundance in Chlamydomonas reinhardtii following nitrogen deprivation predict diversion of metabolism.
Miller Rachel R Wu Guangxi G Deshpande Rahul R RR Vieler Astrid A Gärtner Katrin K Li Xiaobo X Moellering Eric R ER Zäuner Simone S Cornish Adam J AJ Liu Bensheng B Bullard Blair B Sears Barbara B BB Kuo Min-Hao MH Hegg Eric L EL Shachar-Hill Yair Y Shiu Shin-Han SH Benning Christoph C
Plant physiology 20101008 4
Like many microalgae, Chlamydomonas reinhardtii forms lipid droplets rich in triacylglycerols when nutrient deprived. To begin studying the mechanisms underlying this process, nitrogen (N) deprivation was used to induce triacylglycerol accumulation and changes in developmental programs such as gametogenesis. Comparative global analysis of transcripts under induced and noninduced conditions was applied as a first approach to studying molecular changes that promote or accompany triacylglycerol acc ...[more]
Similar Datasets
Project description:Chlamydomonas reinhardtii forms lipid droplets rich in triacylglycerols when nutrient-deprived. To begin studying the mechanisms underlying this process, N-deprivation was used to induce triacylglycerol accumulation and changes in developmental programs such as gametogenesis. Comparative global analysis of transcripts under induced and non-induced conditions was applied as a first approach to study molecular changes that promote or accompany triacylglycerol accumulation in cells encountering a new nutrient environment. Towards this goal, high-throughput sequencing technology was employed to generate large numbers of expressed sequence tags of 8 biologically independent libraries (2 454 libraries, 6 Illumina libraries), four for each condition, N-replete and N-deprived, that allowed a statistically sound comparison of expression levels under the two tested conditions. Inferences on metabolism based on transcriptional analysis can only be indirect but were supported in parts by biochemical experiments. N-deprivation led to a marked redirection of metabolism as the carbon source acetate was no longer converted to cell building blocks by the glyoxylate cycle and gluconeogensis, but funneled directly into fatty acid biosynthesis. Protein biosynthesis and photosynthesis were down-regulated and genes of gametogenesis activated. A notable finding was that the genes encoding photosynthetic accessory PSBS proteins of currently unclear function in C. reinhardtii were strongly expressed following N-deprivation, providing a clue to their physiological role. Lipase-encoding genes were found to be some of the most regulated following N-deprivation, suggesting a remodeling of membranes under these conditions. The data provided here represent a rich source for the exploration of the mechanism of oil accumulation in microalgae. Examing N-replete and N-deprived conditions. One biological replicate each condition.
2010-09-24 | E-GEOD-24366 | biostudies-arrayexpress
Project description:Chlamydomonas reinhardtii forms lipid droplets rich in triacylglycerols when nutrient-deprived. To begin studying the mechanisms underlying this process, N-deprivation was used to induce triacylglycerol accumulation and changes in developmental programs such as gametogenesis. Comparative global analysis of transcripts under induced and non-induced conditions was applied as a first approach to study molecular changes that promote or accompany triacylglycerol accumulation in cells encountering a new nutrient environment. Towards this goal, high-throughput sequencing technology was employed to generate large numbers of expressed sequence tags of 8 biologically independent libraries (6 Illumina libraries, 2 454 libraries), four for each condition, N-replete and N-deprived, that allowed a statistically sound comparison of expression levels under the two tested conditions. Inferences on metabolism based on transcriptional analysis can only be indirect but were supported in parts by biochemical experiments. N-deprivation led to a marked redirection of metabolism as the carbon source acetate was no longer converted to cell building blocks by the glyoxylate cycle and gluconeogensis, but funneled directly into fatty acid biosynthesis. Protein biosynthesis and photosynthesis were down-regulated and genes of gametogenesis activated. A notable finding was that the genes encoding photosynthetic accessory PSBS proteins of currently unclear function in C. reinhardtii were strongly expressed following N-deprivation, providing a clue to their physiological role. Lipase-encoding genes were found to be some of the most regulated following N-deprivation, suggesting a remodeling of membranes under these conditions. The data provided here represent a rich source for the exploration of the mechanism of oil accumulation in microalgae. Examining N-replete and N-deprived conditions. Three biological replicates each condition.
2010-09-24 | E-GEOD-24365 | biostudies-arrayexpress
Project description:Here we generated protein abundance data, covering between 2337 and 3708 proteins, from Chlamydomonas reinhardtii cells grown in various experiments and employed them with constraint-based metabolic models to estimate in vivo maximum apparent turnover numbers for this model organism.
2023-08-01 | PXD037599 | Pride
Project description:We analysed global gene expression changes in Chlamydomonas reinhardtii in response to 1h UV-B, applied at the same low level that was seen to promote subsequent UV-B stress tolerance, in order to elucidate the transcriptional reprogramming that leads to UV-B acclimation. mRNA profiles generated by deep sequencing from triplicate replicate Chlamydomonas reinhardtii samples sourced from independent cultures either protected from UV-B or exposed to 1h acclimation-level UV-B.
2015-11-11 | E-GEOD-68739 | biostudies-arrayexpress
Project description:Alga-derived lipids represent an attractive potential source of biofuels. However, lipid accumulation in algae is a stress response tightly coupled to growth arrest, thereby imposing a major limitation on productivity. To identify master regulators of lipid accumulation and decipher the regulation of lipid biosynthetic pathway, we performed an integrative chromatin signature and transcriptomic analysis in the alga Chlamydomonas reinhardtii. Genome-wide histone modification profiling revealed remarkable differences in functional chromatin states between algae and higher eukaryotes and uncovered regulatory components at the core of lipid accumulation pathways. We identified the transcription factor PSR1 as a pivotal master switch that triggers cytosolic lipid hyper-accumulation an order of magnitude higher than stress regimens have achieved. Dissection of the PSR1 target network corroborates its central role in coordinating multiple stress responses. The comprehensive maps of functional chromatin signatures in a major clade of eukaryotic life and the discovery of a central regulator of algal lipid metabolism will facilitate targeted engineering strategies in microalgae. 1. Genome-wide H3K4me3 time series profiling (at 0 hr, 10 min, 30 min, 1 hr, 2hr, 6 hr, 8 hr, 24 hr and 48 hr after nitrogen starvation) was performed to determine time point to capture maximal chromatin changes. 2. Genome-wide H3K4me3, H3K27ac, H3K9me3, H3K27me3, H3K36me3 and Pol II profiling were performed at 0 hr, 1 hr after nitrogen starvation and 1 hr after sulfur starvation to determine chromatin signatures. Genome-wide H3K4me2 profiling was performed at 0 hr before starvation. 3. Transcriptome time series profiling (at 0 hr, 10 min, 30 min, 1 hr, 2hr, 6 hr, 8 hr, 24 hr and 48 hr after nitrogen and sulfur starvation separately) for chromatin signature characterization and integrative analysis. 4. Genome-wide PSR1 binding profiling was performed with polyclonal antibody against PSR1 peptide A region and PSR1 peptide B region individually. (At 30 min and 1 hr after nitrogen starvation, and 1 hr, 2 hr and 6 hr after sulfur starvation.) Please note that the following reference genome and gene models used in these experiments are linked below; C.reinhardtii_v5.3_genomic_scaffold_plastids.fasta.gz reference_gene_model.gtf.gz These are based off Phytozome (http://www.phytozome.net/) which does not provide access to earlier version data.
2015-07-28 | E-GEOD-59629 | biostudies-arrayexpress
Project description:Like many microalgae unicellular green alga, Chlamydomonas reinhardtii also accumulates energy rich storage lipid and starch under nutrient-limited conditions, such as phosphorus (P) and nitrogen (N) limitation. To dissect the transcriptional regulation of lipid and starch biosynthesis in response to nutrient limitation, we have characterized the biological role of a candidate regulator: the MYB family transcription factor, PSR1 (phosphorus starvation response 1). Genetically modified (psr1 compromised) and wild-type lines were grown under P limiting and sufficient conditions and assayed at two time points by SOLiD RNA-seq.
2016-01-08 | E-MTAB-2556 | biostudies-arrayexpress
Project description:RNA populations in Chlamydomonas reinhardtii Keywords: Highly parallel pyrosequencing Small RNAs were prepared from Chlamydomonas reinhardtii total extracts,ligated to a 3' adaptor and a 5' acceptor sequentially, and then RT-PCR amplified. PCR products were reamplified using a pair of 454 cloning primers and provided to 454 Life Sciences (Branford, CT) for sequencing. For technical details, see Tao Zhao, Guanglin Li, Shijun Mi, Shan Li, Gregory J. Hannon, Xiu-Jie Wang, and Yijun Qi. 2007. A Complex System of Small RNAs in the Unicellular Green Alga Chlamydomonas reinhardtii. Genes & Development
2007-05-15 | E-GEOD-7308 | biostudies-arrayexpress
Project description:Light is the driving force of photosynthesis. However, excessive light can be harmful. Photoinhibition, or lightinduced photodamage, is one of the key processes limiting photosynthesis. When the absorbed light exceeds the amount that can be dissipated by photosynthetic electron flow and other processes, damaging radicals are formed that mostly inactivate photosystem II (PSII). A well defined mechanism that protects the photosynthetic apparatus from photoinhibition has been described in the model green alga Chlamydomonas reinhardtii and plants. Chlorella ohadii is a green microalga, isolated from biological desert soil crusts, that thrives under extreme high light (HL) in which other organisms do not survive. Here, we show that this alga evolved unique protection mechanisms distinct from those of C. reinhardtii and plants. When grown under extreme HL, significant structural changes were noted in the C. ohadii thylakoids, including a drastic reduction in the antennae and the formation of stripped core PSII, lacking its outer and inner antennae. This is accompanied by a massive accumulation of protective carotenoids and proteins that scavenge harmful radicals. At the same time, several elements central to photoinhibition protection in C. reinhardtii, such as psbS, the stress related light harvesting complex (LHCSR), PSII protein phosphorylation and state transitions are entirely absent or were barely detected in C. ohadii.
2023-05-08 | PXD038706 | Pride
Project description:" The novel mass spectrometry quantitation tool pyQms can calculate isotope patterns for molecules that have any isotope enrichment or combinations of, e.g. 13C or 15N and allows partially labeled molecules to be quantified as well, as observed in pulse or pulse-chase experiments where enrichment levels change dynamically. In order to test how pyQms performs on such a task, we created a gold standard (GS) data set of partially labeled proteomes, which allows evaluation of algorithms detecting partial labeld isotopologues against the ground truth against 5 mixed samples. Cultures of Chlamydomonas reinhardtii were grown on medium containing 20, 40, 60, 80 and 100% 15N. Since partially labeled peptides will not produce interpretable fragmentation spectra, each of the partially labeled proteomes were mixed with an unlabeled (14N) or fully labeled (15N) proteome, yielding 5 mixed samples (0|100, 20|100, 40|100, 0|60 and 0|80). " (Modified from manuscript)
2017-08-10 | PXD003236 | Pride
Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic regions. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/
2011-09-12 | E-GEOD-29040 | biostudies-arrayexpress