Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Hypermethylation of miR-34b is associated with CREB overexpression and Myeloid Cell Transformation

ABSTRACT: Increased CREB levels and upregulation of its target genes expression resulted in increased myelopoiesis and colony formation. Class comparison between MDS patients at diagnosis and evolution in AML

ORGANISM(S): Homo sapiens

SUBMITTER: silvia bresolin

PROVIDER: E-GEOD-25300 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

MicroRNA-34b promoter hypermethylation induces CREB overexpression and contributes to myeloid transformation.

Pigazzi Martina M Manara Elena E Bresolin Silvia S Tregnago Claudia C Beghin Alessandra A Baron Emma E Giarin Emanuela E Cho Er-Chieh EC Masetti Riccardo R Rao Dinesh S DS Sakamoto Kathleen M KM Basso Giuseppe G

Haematologica 20121025 4

MicroRNA-34b down-regulation in acute myeloid leukemia was previously shown to induce CREB overexpression, thereby causing leukemia proliferation in vitro and in vivo. The role of microRNA-34b and CREB in patients with myeloid malignancies has never been evaluated. We examined microRNA-34b expression and the methylation status of its promoter in cells from patients diagnosed with myeloid malignancies. We used gene expression profiling to identify signatures of myeloid transformation. We establis ...[more]

PMID: 23100280

Similar Datasets

Project description:We compare here the neurodegenerative processes observed in the hippocampus of bitransgenic mice with chronically altered levels of cAMP-response element-binding protein (CREB) function. The combination of genome-wide transcriptional profiling of degenerating hippocampal tissue with microscopy analyses reveals that the sustained inhibition of CREB function in A-CREB mice is associated with dark neuron degeneration, whereas its strong chronic activation in VP16-CREB mice primarily causes excitotoxic cell death and inflammation. Furthermore, the meta-analysis with gene expression profiles available in public databases identifies relevant common markers to other neurodegenerative processes and highlights the importance of the immune response in neurodegeneration. Overall, these analyses define the ultrastructural and transcriptional signatures associated with these two forms of hippocampal neurodegeneration, confirm the importance of fine-tuned regulation of CREBdependent gene expression for CA1 neuron survival and function, and provide novel insight into the function of CREB in the etiology of neurodegenerative processes. For each mouse genome 430 2.0 gene expression array (Affymetrix, Santa Clara, CA, USA), total RNA was extracted from the hippocampi of three to four mice with the same age, sex, and genotype to produce one pooled sample. We analyzed three late A-CREB pooled samples (6-week-old mice) and three late VP16-CREB pooled samples (3-week-off dox) with their corresponding control littermate samples (three pooled samples for each strain). To compare with early changes, we included two pooled A-CREB early samples (3-week-old mice) and two pooled VP16-CREB early samples (1-week-off dox) with their corresponding control littermate samples. In the case of A-CREB mice, we used the dataset GSE14320. We prepared new samples from bitransgenic mice and control littermates 1 week after transgene induction and hybridized them to mouse genome 430 2.0 genechips. The arrays were hybridized, washed, and screened for quality according to the manufacturerâs protocol.

Project description:Background. The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. Therefore, we propose CREB to be a potential target for therapy. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line. Results. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. The transcription factor Elk-1 was upregulated in response to CREB deletion. Conclusions. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. In particular, we speculate that the regulation of histone genes may play an important role in this process, by possibly altering the regulation of DNA replication during the cell cycle. Experiment Overall Design: Cell lines. The following human leukemia cell lines were transduced with shRNAs: K562 (Iscoves + 10% FCS) and TF-1 (RPMI + 10%FCS + rhGM-CSF. Cells were cultured at 37oC, 5% CO2 and split every 3 to 4 days. Primary AML bone marrow samples were processed as previously described [12]. All human samples were obtained with approval from the Institutional Review Board and consents were signed, according to the Helsinki protocol. Experiment Overall Design: shRNA sequence design and constructs. The CREB specific shRNA sequences were selected and validated based on accepted parameters established by Tuschl et al. [25-27]; CREB shRNA-1, CREB shRNA-2, CREB shRNA-3. Controls included empty vector, luciferase shRNA, and scrambled shRNA. shRNA sequences are: CREB shRNA-1(5âGCAAATGACAGTTCAAGCCC3â), shRNA-2 (5âGTACAGCTGGCTAACAATGG3â), shRNA-3 (5âGAGAGAGGTCCGTCTAATG3â), Luciferase shRNA (5âGCCATTCTATCCTCTAGAGGA3â), Scramble shRNA (5âGGACGAACCTGCTGAGATAT3â). Short-hairpin sequences were synthesized as oligonucleotides and annealed according to standard protocol. Annealed shRNAs were then subcloned into pSICO-R shRNA vectors from the Jacks laboratory at MIT [28]. The second generation SIN vector HIV-CSCG was used to produce human shRNA vectors [29]. Experiment Overall Design: Microarray analysis. Total RNA (10 Î¼g) was extracted from K562 cells transduced with vector alone or CREB shRNA was submitted to the UCLA DNA Microarray Facility. RNA samples were labeled and hybridized by standard protocol to Affymetrix GeneChip Human Genome U133+ Array Set HG-U133A array. Gene expression values were calculated using the MAS5 software. The expression values are quantile normalized across all arrays. We obtained the expression profiles for a control set and CREB downregulated K562 cells. These are first quantile normalized, and then a t-test is performed between the two groups to identify significantly differentially regulated genes. The analysis was performed using Matlab (Mathworks, Inc.). A normal quantile plot of T is shown in figure qqplot.tiff. Data points with t-scores < 1/(2N) display with red circles, were N is the total number of genes. We therefore see that there are a significant number of differentially expressed genes, which are either direct or indirect targets of CREB.

Dataset Information

Hypermethylation of miR-34b is associated with CREB overexpression and Myeloid Cell Transformation

Publications

MicroRNA-34b promoter hypermethylation induces CREB overexpression and contributes to myeloid transformation.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure