Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

11 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Analysis of a normalised equine cDNA library using deep sequencing

ABSTRACT: While a first draft of the equine genome is available and predictions are made regarding resulting genes and proteins, little is known about the actual transcriptome. So far, published expressed sequence tags (ESTs) from different horse tissues were generally rather short (?600bp) and hardly annotated, reflecting the problem that good cDNA libraries are very difficult to analyse. In this approach, we aimed to establish and analyse a normalised immune cell cDNA library (using freshly isolated and activated lymphocytes, NK cells, monocytes and DC). In particular, we wanted to test next generation sequencing combined with a series of bioinformatic approaches. The resulting cDNA library contained 2x107 clones of which 1056 were used for an initial Sanger sequencing and 4x106 for the deep sequencing analysis. Through the latter we obtained >29k sequences for which more than 5000 matches where found on the equine reference sequences. Additionally we could identify more than 3500 sequences which had matches on both - non-equine RNA sequences as well as the equine genome. In these we find both extensions of existing RefSeq models and novel mRNAs alike. Less than 2% of sequences did not have any match in the mentioned databases. 1 pooled set of samples from one animal analysed

ORGANISM(S): Equus caballus

SUBMITTER: Brigitte Waegele

PROVIDER: E-GEOD-26794 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Analysis of a normalised equine cDNA library using deep sequencing

Project description:While a first draft of the equine genome is available and predictions are made regarding resulting genes and proteins, little is known about the actual transcriptome. So far, published expressed sequence tags (ESTs) from different horse tissues were generally rather short (≤600bp) and hardly annotated, reflecting the problem that good cDNA libraries are very difficult to analyse. In this approach, we aimed to establish and analyse a normalised immune cell cDNA library (using freshly isolated and activated lymphocytes, NK cells, monocytes and DC). In particular, we wanted to test next generation sequencing combined with a series of bioinformatic approaches. The resulting cDNA library contained 2x107 clones of which 1056 were used for an initial Sanger sequencing and 4x106 for the deep sequencing analysis. Through the latter we obtained >29k sequences for which more than 5000 matches where found on the equine reference sequences. Additionally we could identify more than 3500 sequences which had matches on both - non-equine RNA sequences as well as the equine genome. In these we find both extensions of existing RefSeq models and novel mRNAs alike. Less than 2% of sequences did not have any match in the mentioned databases.

2012-06-30 | GSE26794 | GEO

RNA Capture-Seq resolves the deep complexity of the human transcriptome (454)

Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic regions. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/

2011-09-12 | E-GEOD-29040 | biostudies-arrayexpress

Extension of 5’ and 3’ ends of human lncRNA transcripts by RACE-coupled long-read high-throughput sequencing (RACE-seq)

Project description:Long non-coding RNAs (lncRNA) constitute a large fraction of mammalian transcriptomes that still remains unexplored, mainly due to the lack of comprehensive, high-quality lncRNA annotation that limits the possibility to fully explore their functional capacity. We have developed RACE-seq, an experimental workflow based on RACE (Rapid Amplification of cDNA Ends) and long read RNA sequencing, aimed at both rare isoform discovery and better definition of gene boundaries. We applied 3â and 5â RACE-seq on 398 low-expressed GENCODE v7 lncRNA genes in seven human tissues (brain, testis, heart, kidney, liver, lung and spleen). The sequences obtained led to the discovery of 2,641 on-target, previously unknown alternative transcripts. Novel isoforms extended 60% of the 398 targeted lncRNA loci further in either 5' or 3', and often reached genome hallmarks typical of gene boundaries. In parallel, we used nested RACE-seq, and confirmed that nested RACE-seq has overwhelmingly better sensitivity than its standard counterpart.

2016-06-01 | E-MTAB-3912 | biostudies-arrayexpress

Structural annotation of equine protein-coding genes determined by mRNA sequencing

Project description:The horse, like a majority of animal species, has a limited amount of species-specific expressed sequence data available in public databases. As a result, structural models for a majority of genes defined in the equine genome are predictions based on ab initio sequence analysis or the projection of gene structures from other mammalian species. The current study used Illumina-based sequencing of messenger RNA (RNA-seq) to help refine structural annotation of equine protein-coding genes and for a preliminary assessment of gene expression patterns. Sequencing of mRNA from eight equine tissues generated 293,758,105 thirty five-base sequence tags, equaling 10.28 giga-basepairs of total sequence data. The tag alignments represent approximately 208X coverage of the equine mRNA transcriptome and confirmed transcriptional activity for roughly 90% of the protein-coding gene structures predicted by Ensembl and NCBI. Tag coverage was sufficient to define structural annotation for 11,356 genes, while also identifying an additional 456 transcripts with exon/intron features that are not listed by either Ensembl or NCBI. Genomic locus data and intervals for the protein-coding genes predicted by the Ensembl and NCBI annotation pipelines were combined with 75,116 RNA-seq derived transcriptional units to generate a consensus equine protein-coding gene set of 20,302 defined loci. Gene ontology annotation was used to compare the functional and structural categories of genes expressed in either a tissue-restricted pattern or broadly across all tissue samples. Examination of 8 equine RNA samples representing 6 distinct tissues

2010-11-10 | E-GEOD-21925 | biostudies-arrayexpress

Analysis of Unannotated Equine Transcripts Identified by mRNA Sequencing

Project description:Horse-specific genes are not readily identified from available equine EST/cDNA resources due to relatively limited coverage. In addition, equine gene sets predicted in silico by Ensembl and NCBI will not identify horse specific genes since they rely on homology-based projection of gene structure annotation from other species. In this study, RNA-seq of 8 equine RNA samples representing 6 distinct tissues was performed and used to improve and refine equine gene structure annotation. The samples and RNA were collected as part of the related study E-GEOD-21925 and are described in Coleman et al 2010. Anim Genet 41 Suppl 2: 121-30 (PMID: 21070285). The RNA from these samples was re-sequenced in this experiment. The tissues were i). the articular cartilage and synovial membrane samples from a 3-year-old male pony. The left carpal joints received four LPS injections (0.5 ng) over 8 days, while the right carpal joints received control injections of PBS. ii) A cerebellum sample was collected from a 2-year-old female thoroughbred. iii) A testis sample from a 4-year-old thoroughbred. iv) A placental villous sample collected immediately post-partum from a full-term female thoroughbred foal. v) A whole embryo sample was obtained from a 34-day-old male thoroughbred conceptus. The embryo, cerebellum, testis and placental samples were of apparent normal gross morphology.

2013-07-30 | E-GEOD-46858 | biostudies-arrayexpress

Whole transcriptome analyses of six thoroughbred horses before and after exercising using RNA-Seq

Project description:We sequenced the whole mRNA of six thoroughbred horse (Equus caballus) blood and muscle tissues before and after exercising, generating a total of 1.3 billion short reads with 90-bp pair-end sequences from 24 samples. Comparing with current genome annotation, we identified 32,361 unigene clusters spanning 51.83 Mb that contained 11,933 (36.87%) annotated genes. More than 60% (20,428) unigene clusters did not match any current equine gene model. We identified 189,973 single nucleotide variations (SNVs) from the aligned sequences against the horse reference. Most SNVs (171,558 SNVs; 90.31%) were novel compared with over 1.1 million equine SNPs from two databases. Some genes have significantly different expression levels under different environment. We define those identical genes which have different expression levels are ‘differentially expressed’ and carried out differentially expressed gene analysis before and after exercise conditions. We discovered, 62 up- and 80 down-regulated genes in the blood and 878 up- and 285 down-regulated genes in the muscle from the 24 samples. Six out of 28 previously exercise-related known genes, HIF1A, ADRB2, PPARD, VEGF, TNC, and BDNF, were highly expressed in the muscle after exercise. We discovered 56 functionally unknown transcription factors that are probably associated with an early regulatory exercise mechanism from 91 differentially expressed transcription factors. We found interesting RNA expression patterns where different alternative splicing forms of the same gene showed reversed expressions before and after exercising. whole mRNA sequencing profiles of six thoroughbred horse (Equus caballus) blood and muscle tissues before and after exercising

2013-05-01 | E-GEOD-37870 | biostudies-arrayexpress

RNA-seq transcriptome profiling of equine inner cell mass and trophectoderm

Project description:Transcriptomic analysis of ICM and TE from in vivo-derived equine blastocysts using Illumina sequencing technology RNA was extracted from individual equine blastocyst ICM and TE (Arcturus Picopure), cDNA was synthesized and amplified (Nugen Ovation V2) and indexed libraries were created for sequencing (TruSeq DNA V1)

2014-05-02 | E-GEOD-51431 | biostudies-arrayexpress

P6 Mouse Sertoli Cell Small RNA seq

Project description:This study annotates the NGS reads in a Sertoli cell sncRNA library. In addition to known sncRNAs, we also identified numerous novel sncRNAs expressed by Sertoli cells. Our data suggest that the Sertoli cell sncRNA transcriptome predominantly consists of miRNAs, piRNA-like RNAs, tRNAs and snoRNAs. This study reports the first comprehensive annotation of the Sertoli cell sncRNA transcriptome. Sertoli cells were purified from post-natal day 6 C57Bl/6 mice using the STAPUT unit gravity sedimentation apparatus. Small RNA was isolated from cells and a cDNA library was generated for 454 sequencing. Sequences from FastA files were initially mapped to known sequences and the genome and subsequently annotated upon novel small RNA categorization.

2012-09-08 | E-GEOD-40692 | biostudies-arrayexpress

Characterization of the piRNA Complex from Rat Testes

Project description:This data series contains the sequences and read counts of Piwi-interacting RNAs and other small RNAs from mouse and rat testes extracts. In a search for different classes of small RNAs that might be involved in transcriptional gene silencing, we encountered a novel class of small RNAs within mammalian testes. This study reports the identification of small RNAs and their relative abundance levels to each other based on the deep coverage of the cDNA library. Keywords: High-throughput pyrosequencing by the 454 Life Sciences Genome Sequencer 20™ System We constructed a cDNA library from small RNAs purified from Q column fractions of testes extracts. Briefly, gel-purified small RNAs from the column fractions were ligated with adaptor oligos on both 3' and 5' ends of the small RNAs. Reverse-transcription and PCR amplification was then performed on the ligated small RNAs to yield a cDNA library. This cDNA library was finally converted by PCR into a single-stranded DNA library compatible for coupling to beads on the 454 Life Sciences Genome Sequencer 20™ System. Reads and sequences of the small RNAs were processed from linker sequences, examined for matches to the mouse or rat genomes, and tallied.

2006-07-02 | E-GEOD-5026 | biostudies-arrayexpress

Equine RNAseq Tissue pool

Project description:This dataset is comprised of RNA samples from 11 horses of various ages and sex that comprise the following tissues: Adipose Tissue, Adrenal Cortex, Adrenal Medulla, Aorta, Articular Cartilage (foal), Bladder, Bone, Bone Marrow, Cecum, Cerebrum, Cornea, Embryo (whole embryo, 34d), Endometrium (preg. day 16), Endometrium (preg. day 50), Epididymus, Hoof (germinal epithelium), Kidney, Large Intestine, Liver, Lung Lymph Node, Lymphocytes (activated), Muscle (cardiac), Muscle (skeletal, tongue), Muscle (skeletal), Muscle (smooth), Ovary, Pancreas, Pituitary (anterior), Pituitary (posterior), Placental Villous, Retina, Salivary Gland, Skin (full thickness), Spinal Cord, Spinal Root Ganglia, Spleen (red pulp), Spleen (white pulp), Stomach, Synovial Membrane, Tendon (superficial digital flexor, foal), Testes, Thymus, and Vena Cava. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. Tissue samples for total RNA isolation were collected under a protocol (00814A2004) reviewed and approved by the Office of Research Integrity, Institutional Animal Care and Use Committee, at the University of Kentucky (PHS Assurance Number: A3336-01). Two micrograms of mRNA from each tissue sample was used to generate the final RNA pool. The pooled sample was Illumina and 454 sequenced with the aim to improve equine gene structural annotation.

2015-05-15 | E-MTAB-2879 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data