Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

MiR-29c Targets Tropomyosin-1M-NM-1 and Is Down-regulated in Rat Remnant Kidneys and IgA Nephropathy Patients with Interstitial Fibrosis

ABSTRACT: MicroRNAs (miRNAs) are small regulatory RNA molecules that modulate the activity of specific mRNA targets and play important roles in a wide range of physiologic and pathologic processes. We hypothesized that miRNAs might be involved in the progression of CKD. In our previous studies we found chronic renal damages developed progressively in rats with 5/6 nephrectomy. L-mimosine(L-Mim) intervention from wk 5 to wk 12 improved renal function and resulted in additional accumulation of HIF-1 M-NM-1 and -2 M-NM-1 at wk 12. In the current study we found miR-29c was up-regulated in the L-Mim treated group compared with the control using Agilent miRNA microarrays. Of the microRNAs and proteins that exhibited reciprocal changes in expression following the L-Mim treatment, miR-29c and tropomyosin 1M-NM-1 (TPM1), which is involved in stress fiber function, met the sequence criteria for microRNA-target interaction, were later confirmed by 3'-untranslated region reporter analysis. TGFM-NM-21 treatment (3 ng/ml, 24 hours) decreased miR-29c expression and up-regulated protein expression of TPM1 in human renal epithelial cells. Overexpression of miR-29c significantly attenuated TGF-M-NM-21 induced increase in TPM1 in vitro. Moreover, intrarenal expression of miR-29c was decreased in IgAN patients with moderate to severe tubulointerstital fibrosis (TIF), compared with IgAN patients without TIF, and intrarenal protein expression of TMP1 was significantly increased in IgAN patients with TIF. The results suggest that intrarenal expression of miR-29c was down-regulated while its predicted target, TPM1 was up-regulated in the progression of CKD. Short term stabilizing of HIF up-regulates miR-29c and attenuates CKD in the remnant kidney model. Four weeks after 5/6 nephrectomy, rats were treated with intraperitoneal injections of vehicle or L-mimosine (L-Mim, Calbiochem), a prolyl 4-hydroxylase inhibitor (PHD), at a dosage of 50 mg/kg every other day. At the end of wk 12 after 5/6 nephrectomy, all rats (n=4, for each group) were sacrificed and blood samples were collected via cardiac puncture. Renal tissue were harvested, one piece of which was fixed in neutral formalin and then embedded in paraffin. The remaining kidney tissue was dissected in ice-cold PBS to, remove medulla, and then snap-frozen in liquid nitrogen before transferring to storage at -80M-BM-0C until further analysis.

ORGANISM(S): Rattus norvegicus

SUBMITTER: Yi Fang

PROVIDER: E-GEOD-28471 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Similar Datasets

Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.

Dataset Information

MiR-29c Targets Tropomyosin-1M-NM-1 and Is Down-regulated in Rat Remnant Kidneys and IgA Nephropathy Patients with Interstitial Fibrosis

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure