Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0

RNA Capture-Seq resolves the deep complexity of the human transcriptome (Illumina)


ABSTRACT: Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic gene deserts. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/

ORGANISM(S): Homo sapiens

SUBMITTER: Tim Mercer 

PROVIDER: E-GEOD-29038 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

altmetric image

Publications

Targeted RNA sequencing reveals the deep complexity of the human transcriptome.

Mercer Tim R TR   Gerhardt Daniel J DJ   Dinger Marcel E ME   Crawford Joanna J   Trapnell Cole C   Jeddeloh Jeffrey A JA   Mattick John S JS   Rinn John L JL  

Nature biotechnology 20111113 1


Transcriptomic analyses have revealed an unexpected complexity to the human transcriptome, whose breadth and depth exceeds current RNA sequencing capability. Using tiling arrays to target and sequence select portions of the transcriptome, we identify and characterize unannotated transcripts whose rare or transient expression is below the detection limits of conventional sequencing approaches. We use the unprecedented depth of coverage afforded by this technique to reach the deepest limits of the  ...[more]

Similar Datasets

2011-09-12 | E-GEOD-29040 | biostudies-arrayexpress
2011-09-12 | GSE29040 | GEO
2011-09-12 | GSE29038 | GEO
| 2612481 | ecrin-mdr-crc
2018-04-26 | GSE113675 | GEO
2026-02-02 | E-MTAB-15148 | biostudies-arrayexpress
2025-09-01 | GSE283136 | GEO
2020-03-10 | GSE128361 | GEO
2014-05-10 | E-GEOD-57536 | biostudies-arrayexpress
2022-08-29 | E-MTAB-10733 | biostudies-arrayexpress