Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

11 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression patterns in response to GATA2 (WT and mutants) in HL-60 cells

ABSTRACT: GATA2 mutants were discovered in families predisposed to MDS/AML and in sporadic cases of CML-blast crisis. Promyelocytic HL-60 cells were transduced with lentiviral vectors that express GATA2 WT or T354M, 355delT or L359V mutants upon addition of 4-hydroxy tamoxifen (4HT). Microarrays were performed to identify GATA2 WT signatures and differences caused by these mutations. HL-60 cells transduced with GATA2 (WT, T354M, 355delT and L359V) lentiviruses were treated with 4HT for 24 hours and RNA isolated and gene expression measured on Affymetrix microarrays.

ORGANISM(S): Homo sapiens

SUBMITTER: Chung Kok

PROVIDER: E-GEOD-29276 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Gene expression patterns in response to GATA2 (WT and mutants) in HL-60 cells

Project description:GATA2 mutants were discovered in families predisposed to MDS/AML and in sporadic cases of CML-blast crisis. Promyelocytic HL-60 cells were transduced with lentiviral vectors that express GATA2 WT or T354M, 355delT or L359V mutants upon addition of 4-hydroxy tamoxifen (4HT). Microarrays were performed to identify GATA2 WT signatures and differences caused by these mutations.

2011-08-20 | GSE29276 | GEO

Raf/MEK signatures in zebrafish liver cells

Project description:An inducible oncogenic cell line ZFL-?Raf1-ER was established, in which oncogenic human Raf-1(?Raf1) can be activated in zebrafish liver cells by administration of 4-hydroxytamoxifen (4HT). Transcriptional profilling of the ZFL-?Raf1-ER cells with and without administration of 4HT and/or the MEK inhibitor U0126 defined the gene signatures transcriptionally regulated by hyperactive Raf/MEK/MAPK signaling in zebrafish liver cells. The ZFL-?Raf1-ER cells were cultured in 12-well plates till confluence. Cell were starved for 4h in plain medium and susequently treated with or without 1µM 4HT and/or 30µM U0126 for 12h. Biological triplications were taken for each condition.

2011-07-07 | E-GEOD-29308 | biostudies-arrayexpress

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

Time-coursed transcriptomics of ATRA-induced granulocytic differentiation

Project description:Transcriptional profiling of HL-60 cells at 0, 3, 24, and 96 h after ATRA treatment. The differentially expressed genes was meant to be the input data for bioinformatic upstream regulator search

2021-09-01 | E-MTAB-10606 | biostudies-arrayexpress

RNA-seq analysis of neutrophils from CD40L-deficient patients and healthy controls, as well as HL-60 promielocytic cell line

Project description:We aim to characterize to effects of the absence of CD40L on neutrophil transcriptome and the effect of soluble CD40L on HL60 cells. For this purpose Total RNA of isolated neutrophils from three CD40L-deficient patients and three healthy controls as well as HL-60 cells from ATCC (HL-60 (ATCC CCL-240) were analyzed by RNAseq. Before RNA obtention, neutrophils were incubated for 2 hours in the presence or absence of 100 U/ml rhIFN- (Immukine, Boehringer Ingelheim), and HL-60 cells cultured for 6 days in the presence or absence of 500 ng/mL sCD40L and/or 1,0 % dimethyl sulfoxide (DMSO).

2017-03-14 | E-MTAB-5316 | biostudies-arrayexpress

Human HL-60 Cells: all-trans retinoic acid (ATRA) vs. ATRA plus arsenic trioxide (ATO)

Project description:Transcriptional profiling of human leukemia?HL-60 cells comparing ATRA treated HL-60 cells with ATRA plus ATO. Goal was to determine the effects of ATO on ATRA induced differentiation of HL-60 cells. Two-condition experiment, ATRA vs. ATRA plus ATO treated HL-60 cells.

2015-03-31 | E-GEOD-67420 | biostudies-arrayexpress

The effect of MPO inhibitor on the gene expression profiles in HL-60 cell lines exposed to 1, 2, 4,-benzenetriol

Project description:To reveal the gene expression profile changes after exposure to BT, one of benzene metabolites, with or without ABAH, a myeloperoxidase (MPO) inhibitor, and to elucidate how MPO is involved in myelotoxicity of BT, we performed microarray analysis. HL-60 cells suspended in RPMI 1640 containing with 10% of heat-inactivated FBS at 4×10^5/ mL were incubated with or without BT (50 μM) at 37℃ for one or 4 hours. For MPO inhibition experiment, HL-60 (4×10^5 cells/ mL) were pretreatment with 100 μM of ABAH in RPMI 1640/10% of heat-inactivated FBS at 37℃ for 24 hours. Media was then replaced with new media containing the regent plus BT (50 μM) and incubate at 37℃ for one or 4 hours. Unexposed HL-60 cells were used as controls. To validate the microarray results, we selected 22 genes and conducted a real-time PCR. Gene expression alteration induced by 50 μM of BT in HL-60 cells, with or without ABAH, was measured at 1 and 4 hours after exposure to it. Three independent experiments were performed at each time (1 or 4 hours).

2013-12-01 | E-GEOD-50805 | biostudies-arrayexpress

Neutrophil-derived pro-inflammatory cytokine response and degranulation in function of time and dose of LPS treatment.

Project description:The purpose of the present study was to elucidate in more details the molecular mechanisms of neutrophil-mediated inflammation. We therefore investigated the time-dependent stimulatory potential of LPS from Escherichia coli on cytokine response in neutrophil-like HL-60 cells. <br><br>To get a general overview on the total mRNA changes in DMSO-differentiated HL-60 cells, we performed whole-transcript analysis of LPS-stimulated dHL-60 cells after 2h and 6h of LPS treatment. The samples were collected from three independent experiments from three different passages in cell culture. Non-stimulated dHL-60 cells served as control. We identified the differentially expressed cytokine genes implicated in the human inflammatory response and prominent for their role in neutrophil-mediated inflammatory processes.

2014-12-17 | E-MTAB-1393 | biostudies-arrayexpress

Dynamic transcriptomes of human myeloid leukemia cells

Project description:To identify the mechanisms controlling chronic myeloid leukemia (CML) and acute myeloid leukemia (AML) in humans, we analyzed genome-wide transcription dynamics in three myeloid leukemia cell lines (K562, HL-60, and THP1) using high-throughput sequencing technology. Using KEGG analysis, we found that the ERK/MAPK, JAK-STAT and ErbB pathways promoted proliferation and metabolism in CML. However, in AML, differentiation and apoptosis blocking resulted in the accumulation of blast cells in marrow. In addition, each cell type had unique characteristics. K562 cells are an ideal model for studying erythroid differentiation and globin gene expression. The chemokine signaling pathway and Fc gamma R-mediated phagocytosis were markedly upregulated in HL-60 cells. In THP1 cells, highly expressed genes ensured strong phagocytosis by monocytes. Further, we provide a new insight into myeloid development. The abundant data sets and well-defined analysis methods will provide a resource and strategy for further investigation of myeloid leukemia. Compare mRNA transcriptomes of three different cell lines

2013-10-09 | E-GEOD-46164 | biostudies-arrayexpress

Cardiac transcription factors in HL-1 cells: gene expression and genome binding profiling

Project description:[1] Gene expression profiling in Gata4, Mef2a knockdown in HL-1 cells. HL-1 cells infected with adenovirus expressing either control siRNA or Gata4, and Gata4 & Mef2a siRNA. [2] Genome-wide maps of cardiac transcription factors binding region in HL-1 cells. We performed bio-ChIP-seq using streptavidin beads immunoprecipitation of biotinylated 5 cardiac transcription factors (fbio) and P300 antibody ChIP-seq. We used a dox-inducible dual adenovirus system to express biotinylated Core Cardiac TFs in HL1. One adenovirus expressed the dox-activated reverse tet activator protein (rtTA) and the E. coli biotinylating enzyme BirA from the cardiac specific rat troponin T promoter. The second virus expressed a Core Cardiac TF fused to a C-terminal flag-bio epitope tag, where bio is the 15 amino acid substrate for BirA. This in vivo biotinylation approach permits pulldown of different factors to be performed under identical, stringent conditions, and circumvents limitations posed by available antibodies. We titrated adenovirus and dox doses to express GATA4flbio and MEF2Aflbio at near endogenous levels. The same conditions were then used to express SRFflbio, TBX5flbio, and NKX2-5flbio. Reference: 12. de Boer E, Rodriguez P, Bonte E, Krijgsveld J, Katsantoni E et al. (2003) Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic mice. Proc Natl Acad Sci U S A 100: 7480-7485. [1] Gene expression profiling: Identify differentially expressed genes after siRNA Gata4 or Gata4_Mef2a double knockdown in HL-1 cells [2] Genome occupancy profiling: Identify cardiac active enhancers by identified 5 cardiac transcription factors and P300 peaks.

2011-03-02 | E-GEOD-21529 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data