Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

16 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Extensive characterization of NF-kappaB binding uncovers non-canonical motifs and advances the interpretation of genetic functional traits

ABSTRACT: We report the DNA binding preferences of 4 NF-kappaB dimers (p52p52, RELARELA, RELAp50, RELAp52) Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

ORGANISM(S): Homo sapiens

SUBMITTER: Jiannis Ragoussis

PROVIDER: E-GEOD-29460 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-M-NM-:B as an example

Project description:We provided an improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor. We valided the strategy by characterzing the DNA-binding specificty of NF-M-NM-:B p50 dimer. Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

2014-05-05 | E-GEOD-48660 | biostudies-arrayexpress

Quantitative modeling of transcription factor binding specificities using DNA shape

Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress

HT-SELEX of recombinant C2H2 zinc finger domains of Sall4

2021-01-05 | E-MTAB-9236 | biostudies-arrayexpress

HT-SELEX of wild-type and mutated versions of recombinant DNA binding domain of SALL4

Project description:To investigate the differences in DNA binding specificity of wild-type SALL4 C2H2 zinc finger cluster 4 (ZFC4) and disease causing mutations in SALL4 ZFC4, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified wild-type SALL4 ZFC4 domain, mutated SALL4 ZFC4 (R900W) and mutated SALL4 ZFC4 (G921D) combined with no protein control experiment.

2023-01-04 | E-MTAB-11519 | biostudies-arrayexpress

HT-SELEX of recombinant C2H2 zinc finger domains of Sall4

Project description:To define the sequence preference of SALL4 C2H2 zinc finger domains, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified SALL4 ZFC1, ZFC2 and ZFC4 domains combined with no protein control experiment. We re-sequenced the libraries from E-MTAB-9236 with very high coverage to estimate the minimum number of reads required per sample for accurate results.

2022-03-01 | E-MTAB-11484 | biostudies-arrayexpress

Quantitative proteomic analysis of proteins bound to rs452384-T or rs452384-C

Project description:This project focuses on the functional characterization of a risk variant (SNP) implicated in the predisposition to uveal melanoma, rs452384. We sought to determine whether some nuclear factors could bind with allele-specificity a DNA sequence centered around rs452384 to regulate gene expression. We sought to identify by quantitative mass spectrometry the nuclear proteins bound to double-stranded DNA probes with identical DNA sequences except for rs452384-C or T alleles in the center of the probe. The goal was to quantify the binding of transcription factors to the DNA probes, and to select those enriched (or specific) to the C or T allele of rs452384. To identify proteins specifically bound to rs452384, we compared binding partners to those obtained with a negative control probe known not to recognize any transcription factor.

2022-11-15 | PXD028954 | Pride

High resolution specificity of DNA sequencing highlights alternative mode of lac repressor binding

Project description:In this work we introduce a new high-throughput method, Spec-seq, that directly measures specificity by sequencing. It has several advantages over existing methods to quantify large collections (thousands) of binding site energies in one experiment. Using lac repressor as an example, we show that this method has excellent reproducibility giving energy measurements generally consistent within about 0.1kT. While not measuring in parallel as many different sequences as some of the higher throughput methods, we obtain high accuracies because we measure exactly what is necessary, the relative affinity to a large collection of sequences, without any mathematical fitting procedures or approximations required. It is similar to MITOMI in the number of different sites that can be analyzed in parallel, but it is much simpler to perform, requiring only a means to separate bound and unbound fractions which are then sequenced using standard high throughput, short read sequencing machines that are now readily available. When applied to the lac repressor we obtain, in a single experiment, data covering a large fraction of all the previous studies, plus thousands of additional variants, allowing us to compile a much more comprehensive profile of its specificity. We learn that the lac repressor can bind to sites of different lengths but that the preferred sequence, and the mode of binding, depends on the length. We also apply the method to two other members of the LacI/GalR protein family, PurR and YcjW, to obtain extensive models of their specificity and test the generality of the lac repressor's ability to bind to operators of variable length. We find that the lac repressor is apparently unique in its ability to bind with high affinity to sites of different lengths and with different modes of binding. 4 independent experiments.

2014-10-01 | E-GEOD-61223 | biostudies-arrayexpress

The SET-domain protein SUVR5 mediates H3K9me2 deposition and silencing at stimulus response genes in a DNA methylation independent manner [SELEX]

Project description:In eukaryotic cells, environmental and developmental signals alter chromatin structure and modulate gene expression. Heterochromatin constitutes the transcriptionally inactive state of the genome and in plants and mammals is generally characterized by DNA methylation and histone modifications such as histone H3 lysine 9 (H3K9) methylation. In Arabidopsis thaliana DNA methylation and H3K9 methylation are usually colocated and set up a mutually self reinforcing and stable state. Here, in contrast, we found that SUVR5, a plant Su(var)3-9 homolog with a SET histone methyltransferase domain, mediates H3K9me2 deposition and regulates gene expression in a DNA-methylation-independent manner. SUVR5 binds DNA through its zinc fingers and represses the expression of a subset of stimulus response genes. This represents a novel mechanism for plants to regulate their chromatin and transcriptional state, which may allow for the adaptability and modulation necessary to rapidly respond to extracellular cues. one experiment and one control.

2014-06-06 | E-GEOD-58034 | biostudies-arrayexpress

LC-MSMS of primary AML class I immunopeptidome (mTECs+MPCs k-mer depletion approach)

Project description:The development of therapeutic anticancer vaccines calls for the identification of tumor-specific antigens (TSAs). Though a combination of four cutting-edge proteogenomic approaches, we performed a deep exploration of the MHC-I presented peptides (MAPs) of 19 acute myeloid leukemia (AML) patients and identified various TSAs that could serve for the design of an anti-AML vaccine.

2021-03-19 | PXD018539 | Pride

Large-scale characterization of DNA binding landscape of eukaryotic C2H2 zinc fingers

Project description:This SuperSeries is composed of the SubSeries listed below. Cys2-His2 zinc finger (C2H2-ZF) proteins represent the largest class of putative human transcription factors (TFs). However, it is unknown whether most C2H2-ZFs even bind DNA, or what sequences they bind. Using a combination of bacterial one-hybrid (B1H) assays, protein-binding microarrays (PBMs), and ChIP-seq, we have found that most natural C2H2-ZFs bind DNA both in vitro and in vivo. This SuperSeries contains the data for identification of C2H2-ZF binding preferences using these three approaches. Refer to individual Series

2015-02-17 | E-GEOD-52523 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data