Genome-wide profiling of small RNAs in Arabidopsis seedlings under salt and cold stresses
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
SUBMITTER: Renyi Liu
PROVIDER: E-GEOD-33642 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:To identify novel miRNA and NAT-siRNAs that are associated with abiotic stresses in sorghum, we generated small RNA sequences from sorghum seedlings that grew under control and under dought, salt, and cold stress treatments. sequencing of small RNAs in sorghum under control, drought, salt, and cold stress conditions.
2015-10-25 | E-GEOD-33237 | biostudies-arrayexpress
Project description:To identify novel miRNA and NAT-siRNAs that are associated with abiotic stresses in Arabidopsis, we generated small RNA sequences from adult Arabidopsis plants under control and under dought, salt, and cold stress treatments. Over 23 million reads were generated. Sequencing of small RNAs in Arabidopsis under control, drought, salt, and cold stress conditions.
2012-03-12 | E-GEOD-26356 | biostudies-arrayexpress
Project description:To identify novel miRNA and NAT-siRNAs that are associated with abiotic stresses in rice, we generated small RNA sequences from inflorescences from rice under control and under dought, salt, and cold stress treatments. Over 30 million reads were generated. sequencing of small RNAs in rice under control, drought, salt, and cold stress conditions.
2012-03-12 | E-GEOD-26357 | biostudies-arrayexpress
Project description:To identify novel microRNAs that are associated with drought tolerance in two different cowpea genotypes, we generated small RNA sequences from adult cowpea plants under control and dought stress treatments. Over 79 million raw reads were generated and numerous novel microRNAs are identified, including some associated with drought tolerance. Sequencing of small RNAs in two cowpea genotypes under control and drought stress conditions.
2011-09-01 | E-GEOD-26402 | biostudies-arrayexpress
Project description:To identify novel miRNA and NAT-siRNAs that are associated with abiotic stresses in maize, we generated small RNA sequences from maize seedlings that grew under control and under dought, salt, and cold stress treatments. Sequencing of small RNAs in maize under control, drought, salt, and cold stress conditions.
2015-10-21 | E-GEOD-33211 | biostudies-arrayexpress
Project description:Small endogenous C. elegans RNAs from L4 and young adult worms were prepared for sequencing using a protocol derived from Batista et al., (2008) and Lau et al. (2001). The small-RNA libraries were constructed using a method that does not require a 5M-bM-^@M-^Y monophosphate (called 5M-bM-^@M-^Y monophosphate-independent method, Ambros et al., 2003) to profile secondary siRNAs that have 5M-bM-^@M-^Y triphosphorylated G. All preprocessed small-RNA reads were mapped to genome (ce6), allowing no mismatches. After excluding miRNAs, 21U RNAs, rRNAs, and other structural ncRNAs, the remaining reads were classified as 22G RNAs, 26G RNAs, and other siRNAs, based on their length and 5M-bM-^@M-2 terminal nucleotide. Small-RNA libraries were sequenced in L4 and young adult stages in C.elegans.
2012-06-12 | E-GEOD-36394 | biostudies-arrayexpress
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:Biotic and abiotic stresses limit agricultural yields, and plants are often simultaneously exposed to multiple stresses. Combinations of stresses such as heat and drought or cold and high light intensity, have profound effects on crop performance and yeilds To analyze such responses, we initially compared transcriptome changes in ten Arabidopsis thaliana ecotypes using cold, heat, high light, salt and flagellin treatments as single stress factors or their double combinations. Arabidopsis thaliana plants of ecotypes (Col, Ler, C24, Cvi, Kas1, An1, Sha, Kyo2, Eri and Kond) were subjected to the following stress treatments: Salt, Cold, Heat, High Light (HL), Salt+Heat, Salt+HL, Cold+HL, Heat+HL, as well as FLG (Flagellin, flg22 peptide), Cold+FLG, Heat+FLG
2013-01-31 | E-GEOD-41935 | biostudies-arrayexpress
Project description:These datasets profile the expression of small RNAs with 5p monophosphates and 3p hydroxyls (including miRNAs, 21U-RNAs) across C. elegans development and in dauer, glp-4 mutant, and mixed-stage wt worms. These datasets were prepared in the David P. Bartel laboratory using T4 RNA ligase Rnl2(1-249). Keywords: miRNA and 21U-RNA discovery and developmental expression profiling CE-devProfile-5pDependent-Illumina 1 flowcell each for Embryo, L1, L2, L3, L4, Adult, Dauer, Glp-4 mutant; 6 flowcells mixed stage
2008-06-15 | E-GEOD-11734 | biostudies-arrayexpress
Project description:ABSTRACT: Exposure to abiotic stresses triggers global changes in the expression of thousands of eukaryotic genes at the transcriptional 70 and post-transcriptional levels. Small RNA (smRNA) pathways and splicing both function as crucial mechanisms regulating stress-responsive gene expression. However, examples of smRNAs regulating gene expression remain largely limited to effects on mRNA stability, translation, and epigenetic regulation. Also, our understanding of the networks controlling plant gene expression in response to environmental changes, and examples of these regulatory pathways intersecting, remains limited. Here, to investigate the role of smRNAs in stress responses we examined smRNA transcriptomes of Brachypodium distachyon plants subjected to various abiotic stresses. We found that exposure to different abiotic stresses specifically induced a group 75 of novel, endogenous small interfering RNAs (stress-induced, UTR-derived siRNAs, or sutr-siRNAs) that originate from the 3M-bM-^@M-2 UTRs of a subset of coding genes. Our bioinformatics analyses predicted that sutr-siRNAs have potential regulatory functions and that over 90% of sutr-siRNAs target intronic regions of many mRNAs in trans. Importantly, a subgroup of these sutr- siRNAs target the important intron regulatory regions, such as branch point sequences, that could affect splicing. Our study indicates that in Brachypodium, sutr-siRNAs may affect splicing by masking or changing accessibility of specific cis-elements 80 through base-pairing interactions to mediate gene expression in response to stresses. We hypothesize that this mode of regulation of gene expression may also serve as a general mechanism for regulation of gene expression in plants and potentially in other eukaryotes. Analysis of smRNA populations in Brachypodium plants challenged by abiotic stresses: To profile the populations of smRNAs in the model monocot Brachypodium distachyon and examine their regulation in response to abiotic stresses, we conducted high-throughput sequencing of small RNAs from plants exposed to four different abiotic stress conditions, cold, heat (air), heat (water immersion), and salt, in the wild type Brachypodium cultivar Bd21. For our experiments we used information from the literature to select two time-points for stress durations, short and long, which differed for each stress: cold (6 and 24 hours), heat-air (1 and 3 hours), heat-water (1 and 3 hours), and salt (48 hours). We generated small RNA libraries for Illumina sequencing (GAII) from the leaves of Brachypodium plants subjected to stresses and selected smRNAs between 15 and 40 nt in length, which we mapped to the Brachypodium genome.
2015-01-20 | E-GEOD-55217 | biostudies-arrayexpress