Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Gene expression signatures in miR-29c overexpressed gastric cancer cells.

ABSTRACT: To explain the mechanism that miR-29c affects the cell proliferation, we attempted to identify the miR-29c target genes in gastric carcinoma. The expression profiles in MKN45, MKN7 and MKN74 cells transfected with miR-29c oligo or Negative control oligo were obtained from microarray analysis. Then, the genes differentially expressed (Fold change >= 2.0) in miR-29c-transfected cells compared with negative control-transfected ones were identified in each cell lines, respectively. The differentially expressed genes shared among 3 cell lines were identified as the candidates for miR-29c targets. Human gastric cancer cell lines, MKN45, MKN74 and MKN7 were transfected with miR-29c oligo or negative control oligo (n=2) (Ambion). At 24h after, total RNA was extracted and microarray analysis was performed. The genes with common expression changes among three cell lines miR-29c-transfected were identified as the candidates for miR-29c targets.

ORGANISM(S): Homo sapiens

SUBMITTER: Yoshiyuki Tsukamoto

PROVIDER: E-GEOD-38581 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

MiR-29c is downregulated in gastric carcinomas and regulates cell proliferation by targeting RCC2.

Matsuo Mitsuhiro M Nakada Chisato C Tsukamoto Yoshiyuki Y Noguchi Tsuyoshi T Uchida Tomohisa T Hijiya Naoki N Matsuura Keiko K Moriyama Masatsugu M

Molecular cancer 20130225

<h4>Background</h4>Previously, using miRNA microarray, we have found that miR-29c is significantly downregulated in advanced gastric carcinoma. In the present study, we investigated whether miR-29c functions as a tumor-suppressor miRNA in gastric carcinoma cells. For this purpose, we verified the downregulation of miR-29c in gastric carcinoma tissues, and assessed the biological effect of miR-29c on gastric carcinoma cells.<h4>Results</h4>In miR-29c-transfected cells, both proliferation and colo ...[more]

PMID: 23442884

Similar Datasets

Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.

Dataset Information

Gene expression signatures in miR-29c overexpressed gastric cancer cells.

Publications

MiR-29c is downregulated in gastric carcinomas and regulates cell proliferation by targeting RCC2.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure