Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

9 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The Aurora B kinase and the polycomb protein Ring1B combine to regulate active promoters in quiescent lymphocytes [RNA-Seq]

ABSTRACT: Expression profiling of resting B cells to classify active and silent genes based on expression levels 4 biological replicates of mRNA extracted from freshly purified mouse CD43 negative resting B cells

ORGANISM(S): Mus musculus

SUBMITTER: Gopuraja Dharmalingam

PROVIDER: E-GEOD-42704 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

The Aurora B kinase and the polycomb protein Ring1B combine to regulate active promoters in quiescent lymphocytes

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2013-09-27 | E-GEOD-42706 | biostudies-arrayexpress

The Aurora B kinase and the polycomb protein Ring1B combine to regulate active promoters in quiescent lymphocytes [ChIP-seq]

Project description:Genome-wide distribution of proteins and histone marks in CD43 negative mouse resting B cells ChIP-seq analyses of Aurora B, Ring1B, Bcx7, USP16, H3K27me3, and Ezh2 were carried out on wild-typeCD43 negative resting B cells. ChIP-seq datasets obtained from Aurora B knockout and RingiB knockout cells were used as negative controls to validate the signals for Aurora B and Ring1B from wild-type cells. 8WG16 ChIP-seq datasets were generated from WT (Cre-ERt2 homozygous) and Ring1B KO (Cre-ERt2/Rnf2 flox homozygous). RNAP-S5ph ChIP-seq datasets were generated from WT (Cre-ERt2 homozygous) and Aurkb KO (Cre-ERt2/Aurkb flox homozygous). ChIP-seq analyses of H3S28 phosphorylation (H3S28ph) and H2AK119 monoubiquitination (H2Aub1) in wild-type (Cre-ERt2 homozygous) and Aurora B KO (Cre-ERt2/Aurkb flox homozygous) CD43 negative resting B cells treated with 250nM tamoxifen (4-hydroxytamoxifen) for 48 hours. ChIP-seq analyses of the levels of unphosphorylated RNA Pol II (8WG16) and serine 5-phosphorylated RNA Pol II (RNAP-S5ph) were conducted in Aurkb KO (Cre-ERt2/Aurkb flox homozygous) and Ring1B KO (Cre-ERt2/Rnf2 flox homozygous) CD43 negative resting B cells treated with 250nM tamoxifen (4-hydroxytamoxifen) for 48 hours respectively). All libraries were prepared from sonicated, formaldehyde-crossilinked chromatin. For H2Aub1, ChIP was performed using micrococcal nuclease-digested, unfixed chromatin, instead.

2013-09-27 | E-GEOD-42705 | biostudies-arrayexpress

Genome wide localization of Activation induced cytidine deaminase (AID), Spt5, and RNA Polymerase II (PolII) in mouse

Project description:Activation induced cytidine deaminase (AID) initiates antibody gene diversification by creating U:G mismatches. However, AID is not specific for antibody genes. Off-target lesions can activate oncogenes or cause chromosome translocations. Despite its importance in these key transactions little is known about how AID finds its target sites. To examine AID regulation we performed an shRNA screen. We found that Spt5, a factor associated with paused RNA polymerase II (Pol II) and single stranded DNA (ssDNA), is required for class switch recombination (CSR). Spt5 interacts with AID, it is required for the association of AID and Pol II, and for AID recruitment to switch regions. ChIP-seq experiments reveal that Spt5 co-localizes with AID and stalled Pol II. Further, Spt5 accumulation at sites of Pol II pausing is predictive of AID-induced mutation. Our data suggest that Spt5 acts as an adaptor, which brings AID to Pol II on target DNA. PolII, AID, and Spt5 were immunoprecipitated from in vitro activated B cells. For Spt5 and AID, two different antibodies were used in separate, biological replicates

2010-10-05 | E-GEOD-24178 | biostudies-arrayexpress

Genome-wide mapping of early replication fragile sites (ERFS)

Project description:DNA double strand breaks (DSBs) in B lymphocytes are thought to arise stochastically during replication (S phase) or as a result of targeted DNA damage by activation induced cytidine deaminase (AID) in G1. Here we identify a novel class of recurrent, early replicating and AID independent DNA lesions, termed early replication fragile sites (ERFS), by genome-wide localization of DNA repair proteins DNA double strand breaks (DSBs) in B lymphocytes are thought to arise stochastically during replication (S phase) or as a result of targeted DNA damage by activation induced cytidine deaminase (AID) in G1. Here we identify a novel class of recurrent, early replicating and AID independent DNA lesions, termed early replication fragile sites (ERFS), by genome-wide localization of DNA repair proteins DNA double strand breaks (DSBs) in B lymphocytes are thought to arise stochastically during replication (S phase) or as a result of targeted DNA damage by activation induced cytidine deaminase (AID) in G1. Here we identify a novel class of recurrent, early replicating and AID independent DNA lesions, termed early replication fragile sites (ERFS), by genome-wide localization of DNA repair proteins RPA, SMC5, gamma-H2AX, and BRCA1 in B cells subjected to replication stress. Protein-DNA association for four DNA damage response proteins (RPA, SMC5, g-H2AX, BRCA1), BrdU incorporation, and gene transcription in B lymphocytes with and without hydroxyurea treatment were examined.

2013-02-04 | E-GEOD-43504 | biostudies-arrayexpress

Dynamic BRG1 Recruitment During T Helper Differentiation And Activation Reveals Distal Regulatory Elements

Project description:We found binding of the remodeling protein BRG1 was programmed by lineage and activation signals. BRG1 binding was positively correlated with gene activity at protein-coding and miRNA genes. BRG1 binding was found at promoters and distal regions, including known and novel distal regulatory elements. Distal BRG1 binding correlated with expression, and novel distal sites possessed enhancer activity, suggesting a general role for BRG1 in long-distance gene regulation. Together, these findings suggest BRG1 interprets differentiation and activation signals and plays a causal role in gene regulation, chromatin structure, and cell fate. Our findings indicate BRG1 binding is a useful marker for identifying cis-regulatory regions in protein-coding and miRNA genes. Compare BRG1 binding in T helper subsets genome wide; Naïve, resting Th1, resting Th2, Stimulated Th1, Stimulated Th2, Stimulated Th17, compared to input DNA as negative control

2011-03-01 | E-GEOD-23719 | biostudies-arrayexpress

Genome wide localization of CTCF in activated mouse B cells

Project description:Identify CTCF binding sites in activated mouse B cells. Single ChIP experiment

2011-11-19 | E-GEOD-33819 | biostudies-arrayexpress

RPA accumulation during class switch recombination represents 5'-3' DNA end resection during the S-G2/M phase of the cell cycle

Project description:AID promotes chromosomal translocations by inducing DNA double-strand breaks (DSBs) at immunoglobulin (Ig) genes and oncogenes in G1. RPA is a ssDNA-binding protein that associates with resected DSBs in the S phase and facilitates the assembly of factors involved in homologous repair (HR) such as Rad51. Notably, RPA deposition also marks sites of AID-mediated damage, but its role in Ig gene recombination remains unclear. Here we demonstrate that RPA associates asymmetrically with resected ssDNA in response to lesions created by AID, RAG, or other nucleases. Small amounts of RPA are deposited at AID targets in G1 in an ATM-dependent manner. In contrast, recruitment in S-G2/M is extensive, ATM-independent, and associated with Rad51 accumulation. RPA in S-G2/M increases in NHEJ-deficient lymphocytes, where there is more extensive DNA-end resection. Thus, most RPA recruitment during CSR represents salvage of un-repaired breaks by homology-based pathways during the S-G2/M phases of the cell cycle. Chip-Seq of RPA from mouse activated B cells (n = 40), mouse thymocytes (n = 6), and MEFs (n = 1). Different genotypes and/or inhibitors were used.

2013-01-02 | E-GEOD-42451 | biostudies-arrayexpress

RNA-SEQ on resting (R) and stimulated (S) B cells from several IgH 3'RR mutant models

Project description:We evaluated by RNA-seq obveral transcripts in B cells (resting and activated for 2 days with LPS) sorted from several KO mice models devoid of portion or all the IgH 3' Regulatory Region One RNA-seq point was realized per condition (resting or stimulated) and per genotype. Each point corresponds to a pool of equivalent number of B cells sorted from 4 animals

2016-03-02 | E-GEOD-76217 | biostudies-arrayexpress

microRNA expression profile of activated primary B cells and miR181b overexpressing primary B cells

Project description:This SuperSeries is composed of the following subset Series: GSE12156: Murine spleen B cells miR181b vs control (G4122A) GSE12158: Murine spleen B cells miR181b vs control (G4122F) GSE12176: microRNA expression profile of activated versus non activated primary B cells Refer to individual Series

2008-08-20 | E-GEOD-12186 | biostudies-arrayexpress

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data