BEAS-2B cells: Control versus chemical exposure
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Sylvie Remy
PROVIDER: E-GEOD-44729 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, SigmaM-bM-^@M-^SAldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (SigmaM-bM-^@M-^SAldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (SigmaM-bM-^@M-^SAldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturerM-bM-^@M-^Ys instructions. RNA samples from three independent experiments were used for microarray analysis.
2014-08-02 | E-GEOD-60003 | biostudies-arrayexpress
Project description:Background The implication of post-transcriptional regulation by microRNAs in molecular mechanisms underlying cancer disease is well documented. However, their interference at the cellular level is not fully explored. Functional in vitro studies are fundamental for the comprehension of their role; nevertheless results are highly dependable on the adopted cellular model. Next generation small RNA transcriptomic sequencing data of a tumor cell line and keratinocytes derived from primary culture was generated in order to characterize the microRNA content of these systems, thus helping in their understanding. Both constitute cell models for functional studies of microRNAs in head and neck squamous cell carcinoma (HNSCC), a smoking-related cancer. Known microRNAs were quantified and analyzed in the context of gene regulation. New microRNAs were investigated using similarity and structural search, ab initio classification, and prediction of the location of mature microRNAs within would-be precursor sequences. Results were compared with small RNA transcriptomic sequences from HNSCC samples in order to access the applicability of these cell models for cancer phenotype comprehension and for novel molecule discovery. Results Ten miRNAs represented over 70% of the mature molecules present in each of the cell types. The most expressed molecules were miR-21, miR-24 and miR-205, Accordingly; miR-21 and miR-205 have been previously shown to play a role in epithelial cell biology. Although miR-21 has been implicated in cancer development, and evaluated as a biomarker in HNSCC progression, no significant expression differences were seen between cell types. We demonstrate that differentially expressed mature miRNAs target cell cycle progression and apoptosis related biological processes, indicating that they might represent, with acceptable accuracy, the genetic context from which they derive. Most miRNAs identified in the cancer cell line and in keratinocytes were present in tumor samples and cancer-free samples, respectively, with miR-21, miR-24 and miR-205 still among the most prevalent molecules at all instances. Thirteen miRNA-like structures, containing reads identified by the deep sequencing, were predicted from putative miRNA precursor sequences. Strong evidences suggest that one of them could be a new miRNA. This molecule was mostly expressed in the tumor cell line and HNSCC samples indicating a possible biological function in cancer. Conclusions Critical biological features of cells must be fully understood before they can be chosen as models for functional studies. Expression levels of miRNAs relate to cell type and tissue context. This study provides insights on miRNA content of two cell models used for cancer research. Pathways commonly deregulated in HNSCC were targeted by most expressed and also by differentially expressed miRNAs. Results indicate that the use of cell models for cancer research demands careful assessment of underlying molecular characteristics for proper data interpretation. Additionally, one new miRNA-like molecule with a potential role in cancer was identified in the cell lines and clinical samples. This submission represents the gene expression component of the study only Microarray analysis was performed using Agilent Whole Human Genome Microarray 4M-CM-^W44K arrays and labeled using the One Color Quick Amp Labeling Kit (Agilent Technologies). A total of four samples were analyzed: two biological replicates of SCC25 and two biological replicates of normal keratinocytes. Hybridization and washing followed protocols described by the manufacturer (Agilent Technologies). The one-color arrays were scanned by GenePix 4000B Scanner (Axon), and analyzed using the Agilent Feature extraction software (version 9.5). The quality control of the microarrays was assessed using the standard Agilent controls to verify that the arrays met the expected criteria.
2013-12-30 | E-GEOD-41436 | biostudies-arrayexpress
Project description:A2780 ovarian cancer cells and a cisplatin resistant derivate of A2780 cells, obtained from ECACC, UK, No. 93112519 [A2780] and No. 93112517 [A2780 cis] were seeded out in T-75 flasks at a density of 2x106 for A2780sens and 3x106 for A2780cis cells in 15 ml of medium and preincubated overnight. Medium was removed and 15 ml fresh medium (37M-0C) with different concentrations of cisplatin, liposomal cisplatin or empty liposomes were added and incubated for 72 h at 37M-0C in a 5% CO2 incubator. In case of A2780sens cells, 1.72 M-5M cisplatin (IC50 concentration) and in case of A2780cis cells 8.94 M-5M cisplatin (IC50 concentration) were added. Liposomal formulations contained equal cisplatin concentrations. Empty liposomes were added in the same concentration as the liposomal cisplatin, to analyze the impact of liposomal lipids (A2780sens: 0.80M-5mol lipid, A2780cis: 4.15 M-5mol lipid). After incubation, medium was removed and cells were washed thrice with 10 ml PBS. 1 ml RLT-buffer was added and cells lysates were stored at -80M-0C until RNA extraction.
2010-12-13 | E-MEXP-2840 | biostudies-arrayexpress
Project description:Transcript levels of all T. pseudonana genes was measured every twelve hours throughout the batch (non-chemostatic) growth of axenic cells grown in large glass bioreactors on a 12hr:12hr dark:light cycle for five days. The data were analyzed to reveal the physiological and regulatory changes that recurred in this diatom when transitioning between dark and light conditions, as well as from exponential phase to stationary, nutrient limited conditions. The longitudinal experiment was performed with two replicates, at 400 and 800ppm CO2. Two growth experiments were conducted, with 10 and 9 longitudinal samples collected from each experiment, respectively. Two-color arrays were used with dye flips for labeling. A common internal reference sample was used for one channel on each array. Expression changes for longitudinal analysis were calculated as the difference from the mean log2 expression ratio for each to the common reference sample, for each gene, over all samples within an experiment. For the analysis of diel states in T. pseudonana, samples from the two series were matched according to the time from innoculation, and divided into four classes: dawn samples (taken at the end of each dark phase), dusk samples (taken at the end of each light phase), exponential samples (the first five samples in each series prior to a drop in growth rate on Day 3), and stationary samples (all samples including following the drop in growth rate on Day 3).
2013-04-18 | E-GEOD-45252 | biostudies-arrayexpress
Project description:Mantle cell lymphoma (MCL) is an aggressive B-cell non-HodgkinM-bM-^@M-^Ys lymphoma (NHL). In cancers, tumour suppressive microRNAs may be silenced by DNA hypermethylation. By microRNA profiling, miR-155-3p was significantly upregulated upon demethylation treatment of MCL cell lines with 5-aza-2M-bM-^@M-^Y-deoxycytidine (5-azadC). Methylation-specific PCR, verified by pyrosequencing, showed complete methylation of miR-155-3p in one MCL cell line (REC-1). 5-azadC treatment of REC-1 led to demethylation and re-expression of miR-155-3p. Over-expression of miR-155-3p led to increased sub-G1 apoptotic cells and reduced cellular viability, demonstrating its tumour suppressive properties. By luciferase assay, lymphotoxin-beta (LT-M-NM-2) was validated as a miR-155-3p target. In 31 primary MCL, miR-155-3p was found hypermethylated in 6(19%) cases. To test if methylation of miR-155-3p was MCL-specific, miR-155-3p methylation was tested in an additional 191 B-cell, T-cell and NK-cell NHLs, yielding miR-155-3p methylation in 66(34.6%) including 36(27%) non-MCL B-cell, 24(53%) T-cell and 6(46%) of NK-cell lymphoma. Moreover, in 72 primary NHL samples with RNA, miR-155-3p methylation correlated with miR-155-3p downregulation (p=0.030), and LT-M-NM-2 upregulation (p=0.004). Collectively, miR-155-3p is tumour suppressive microRNA hypermethylated in MCL and other NHL subtypes. As miR-155-3p targets LT-M-NM-2, which is an upstream activator of the non-canonical NF-kB signalling, miR-155-3p methylation is potentially important in lymphomagenesis Total RNA isolated from MINO and JEKO-1 before and after 5-azadC treatment were converted into cDNA by MegaplexTM RT Primers and TaqManM-BM-. MicroRNA Reverse Transcription Kit. cDNA was pre-amplified using MegaplexTM PreAmp Primer and loaded onto 384-well format TaqmanM-BM-. human microRNA array A V2.0 & B V3.0. Real-time PCR was performed on 7900HT Real-Time PCR system and raw data were analyzed normalizing to mean of three endogenous controls (U6snRNA, RNU44 and RNU48). Relative microRNA levels were determined by M-NM-^TM-NM-^TCt using endogenous controls and untreated controls using SDS 2.4 and RQ manager 1.2. All experimental procedures and analyses were performed according to manufacturerM-bM-^@M-^Ys instruction, using reagents, system and softwares acquired from Applied Biosystems (Foster City, USA).
2014-08-31 | E-GEOD-57128 | biostudies-arrayexpress
Project description:Transcriptonal profiling of BEAS-2B cells: Control versus skin sensitizers; Control versus respiratory sensitizers; Control versus non-sensitizing irritants
2013-12-01 | GSE44729 | GEO
Project description:Genomic imprinting describes the expression of a subset of mammalian genes from one parental chromosome. The parent-of-origin specific expression of imprinted genes relies on DNA methylation of CpG-dinucleotides at differentially methylated regions (DMRs) during gametogenesis. We identified the paternally methylated DMRs at mouse chromosome 1 near the imprinted Zdbf2 gene using a methylated-DNA immunoprecipitation-on-chip (meDIP-on-chip) method applied to DNA from parthenogenetic (PG)- and androgenetic (AG)-derived cells and sperm. To identify novel DMRs, genome-wide methylation analysis of three samples were performed using MeDIP and whole genome tiling array.
2010-05-04 | E-GEOD-18126 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the following subset Series: GSE18126: Methylation status in AG- and PG-derived cells and sperm GSE18178: Methylation status in human sperm Refer to individual Series
2010-05-04 | E-GEOD-21662 | biostudies-arrayexpress
Project description:Transcriptional profiling of a unicelluar diazotrophic cyanobacterium Cyanothece sp. ATCC 51142 in constant light under nitrogen fixing condition. The controls comprised of equimolar pool of RNA from all time points. Cyanothece sp. ATCC 51142 was grown in BG-11 medium without nitrate. The culture was entrained under 12 h alternate light/dark cycles for 96 h and released in constant light (LL). Nine samples were for two consecutive cycles under LL, at times when the culture underwent transitions in its photosynthetic and respiratory phases, as indicated by the exit CO2 and O2 profiles. Two biological replicates, two technical replicates and a dye swap were analyzed for each sample from individual time points.
2015-02-03 | E-GEOD-65429 | biostudies-arrayexpress
Project description:Alterations in chromatin modifications, including DNA methylation and histone modification patterns, have been characterized under exposure of several environmental pollutants, including nickel. As with other carcinogenic metals, the mutagenic potential of nickel compounds is low and is not well correlated with its carcinogenic effects. Nickel exposure, however, is associated with alterations in chromatin modifications and related transcriptional programs, suggesting an alternative pathway whereby nickel exposure can lead to disease. To investigate the extent to which nickel exposure disrupts chromatin patterns, we profiled several histone modifications, including H3K4me3, H3K9ac, H3K27me3 and H3K9me2 as well as the insulator binding protein CTCF and the transcriptomes of control BEAS-2B cells and cells treated with nickel for 72 hours. Our results show significant alterations of the repressive histone modification H3K9me2 in nickel-exposed cells with spreading of H3K9me2 into new domains associated with gene silencing. We furthermore show that local regions of active chromatin can protect genes from nickel-induced H3K9me2 spreading. Interestingly, we show that nickel exposure selectively disrupts weaker CTCF sites, leading to spreading of H3K9me2 at these regions. These results have major implications in the understanding of how environmental carcinogens can affect chromatin dynamics and the consequences of chromatin domain disruption in disease progression. Treat BEAS-2B cells with NiCl2 for 72 hours and compare histone modification, CTCF binding to control BEAS-2B cells to see how they regulated gene expression by RNA-seq
2014-09-26 | E-GEOD-56051 | biostudies-arrayexpress