ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
SUBMITTER: Yu Chen
PROVIDER: E-GEOD-47220 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection
2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress
Project description:We performed expression mouse profiling of prostates of 3 month PTEN f/f and Pten f/f;R26(ERG) mice and assessed the response to 3 days of castration. Mice are in the C57B6 background. Two mice in each group were castrated. Three days after castration, the prostate were harvested and RNA isolated by standard protocols and analyzed by expression profiling.
2013-04-25 | E-GEOD-46360 | biostudies-arrayexpress
Project description:We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice. For WT and ERG prostates, entire prostates were dissected and total RNA immediated harvested. For Pten f/f and Pten f/f;ERG prostates, the Ventral Lobe was dissected. Mice are in the C57B6 background. The prostate were harvested and RNA isolated by standard protocols and analyzed by expression profiling.
2013-05-10 | E-GEOD-46799 | biostudies-arrayexpress
Project description:We performed expression profiling of prostates of 3 month wild-type and PTEN NULL mice and assessed the response to 3 days of castration. Seven three month old WT and PbCre x PTEN f/f (PTEN NULL) mice were used. They are in the C57B6 background. Three mice in each group were castrated. Three days after castration, the prostate were harvested and RNA isolated by standard protocols and analyzed by expression profiling.
2011-05-19 | E-GEOD-24691 | biostudies-arrayexpress
Project description:The MR is an endocytic receptor, which plays an important role in serum homeostasis and antigen presentation. In this study, we firstly describe an important role of the MR as a direct regulator of CD8+ T cell activity. We could demonstrate that the presence of the MR on DCs impaired the cytotoxicity of activated CD8+ T cells both in vitro and in vivo. This regulatory effect was mediated by a direct interaction of the MR with CD45 on the T cells surface, which abolished CD45 activity. MR-mediated suppression of CD45 resulted in the up-regulation of the inhibitory molecule CTLA-4, which in turn was responsible for the reduced T cell activity. MR-mediated inactivation of CD45, up-regulation of CTLA-4 and T cell inactivation could be circumvented by increased signaling via CD28, which was achieved by DC maturation. These implications point out an important role of the MR in maintaining the balance between tolerance and immunity and might have pivotal implications for the development of vaccination strategies aimed at dampening adaptive immunity. DesTCR T cells were incubated with MR-deficient DCs in the presence of FcMR or isotype controls for the indicated time points. Afterwards, CD8+ T cells were isolated by cell sorting (FACSAria), and immediately lysed in Trizol (Invitrogen) before storage at -80°C for RNA isolation.
2016-08-23 | E-GEOD-45805 | biostudies-arrayexpress
Project description:The mutational status of the immunoglobulin heavy chain variable region (IGHV) defines two clinically distinct forms of chronic lymphocytic leukemia (CLL) known as mutated (M-CLL) and un-mutated (UM-CLL). To elucidate the molecular mechanisms underlying the adverse clinical outcome associated with UM-CLL, total proteomes from 9 UM-CLL and 9 M-CLL samples were analysed by isobaric tags for relative and absolute quantification (iTRAQ)-based mass spectrometry. Unsupervised clustering, based on the expression of 3521 identified proteins, separated CLL samples into two groups corresponding to IGHV mutational status. Computational analysis showed that 43 cell migration/adhesion pathways were significantly enriched by 39 differentially expressed proteins, 35 of which were expressed at significantly lower levels in UM-CLL samples. Furthermore, UM-CLL cells under-expressed proteins associated with cytoskeletal remodelling and over-expressed proteins associated with transcriptional and translational activity. Taken together, our findings indicated that UM-CLL cells are less migratory and more adhesive than M-CLL cells, resulting in their retention in lymph nodes where they are exposed to proliferative stimuli. In keeping with this hypothesis, analysis of an extended cohort of 120 CLL patients revealed a strong and specific association between UM-CLL and lymphadenopathy. Our study illustrates the potential of total proteome analysis to elucidate pathogenetic mechanisms in cancer.
2016-06-27 | PXD001516 | Pride
Project description:The mutational status of the immunoglobulin heavy chain variable region (IGHV) defines two clinically distinct forms of chronic lymphocytic leukemia (CLL) known as mutated (M-CLL) and un-mutated (UM-CLL). To elucidate the molecular mechanisms underlying the adverse clinical outcome associated with UM-CLL, total proteomes from 9 UM-CLL and 9 M-CLL samples were analysed by isobaric tags for relative and absolute quantification (iTRAQ)-based mass spectrometry. Unsupervised clustering, based on the expression of 3521 identified proteins, separated CLL samples into two groups corresponding to IGHV mutational status. Computational analysis showed that 43 cell migration/adhesion pathways were significantly enriched by 39 differentially expressed proteins, 35 of which were expressed at significantly lower levels in UM-CLL samples. Furthermore, UM-CLL cells under-expressed proteins associated with cytoskeletal remodelling and over-expressed proteins associated with transcriptional and translational activity. Taken together, our findings indicated that UM-CLL cells are less migratory and more adhesive than M-CLL cells, resulting in their retention in lymph nodes where they are exposed to proliferative stimuli. In keeping with this hypothesis, analysis of an extended cohort of 120 CLL patients revealed a strong and specific association between UM-CLL and lymphadenopathy. Our study illustrates the potential of total proteome analysis to elucidate pathogenetic mechanisms in cancer.
2016-06-27 | PXD001515 | Pride
Project description:The mutational status of the immunoglobulin heavy chain variable region (IGHV) defines two clinically distinct forms of chronic lymphocytic leukemia (CLL) known as mutated (M-CLL) and un-mutated (UM-CLL). To elucidate the molecular mechanisms underlying the adverse clinical outcome associated with UM-CLL, total proteomes from 9 UM-CLL and 9 M-CLL samples were analysed by isobaric tags for relative and absolute quantification (iTRAQ)-based mass spectrometry. Unsupervised clustering, based on the expression of 3521 identified proteins, separated CLL samples into two groups corresponding to IGHV mutational status. Computational analysis showed that 43 cell migration/adhesion pathways were significantly enriched by 39 differentially expressed proteins, 35 of which were expressed at significantly lower levels in UM-CLL samples. Furthermore, UM-CLL cells under-expressed proteins associated with cytoskeletal remodelling and over-expressed proteins associated with transcriptional and translational activity. Taken together, our findings indicated that UM-CLL cells are less migratory and more adhesive than M-CLL cells, resulting in their retention in lymph nodes where they are exposed to proliferative stimuli. In keeping with this hypothesis, analysis of an extended cohort of 120 CLL patients revealed a strong and specific association between UM-CLL and lymphadenopathy. Our study illustrates the potential of total proteome analysis to elucidate pathogenetic mechanisms in cancer.
2016-06-27 | PXD001512 | Pride
Project description:Tumor growth reduction induced by anthracycline-based chemotherapy is largely determined by an anticancer immune response that is ignited by the presentation of dead-cell antigens by intratumoral dendritic cells. In an unbiased screen designed to identify cancer therapy-relevant single nucleotide polymorphisms in genes affecting the interaction between dying tumor cells and immune cells, we identified a loss-of-function allele of the gene coding for formyl peptide receptor 1 (FPR1) that was associated with poor metastasis-free and overall survival in breast cancer patients receiving adjuvant chemotherapy. In mice, the therapeutic effects of anthracyclines were abrogated when the immune system was rendered deficient for FPR1 or when tumor cells lacked the FPR1 ligand Annexin A1 (ANXA1). Defective anticancer immune responses from FPR1 knockout mice could be attributed to the failure of dendritic cells to approach dying tumor cells and hence to present tumor cell antigens to T lymphocytes. Experiments performed in a microfluidic device confirmed the obligatory contribution of ANXA1 and FPR1 to the induction of stable conjugates between dying tumor cells and human or murine leukocytes. Altogether, these results underscore the functional and clinical importance of FPR1 in determining chemotherapy-relevant anticancer immune responses. When the surface of tumor reached 25-45 mm2 after subcutaneous tumor cell innoculation, mice received 2.9 mg/Kg intratumoral doxorubicin (DX) (in 50 μL PBS). Two days after treatment, tumor samples were harvested, rinsed briefly with cold PBS and immediately preserved in RNAlater RNA Stabilization Reagent (Qiagen) overnight at 4°C. Samples were then snap-frozen in liquid nitrogen and stored at -80°C before RNA isolation.
2016-04-04 | E-GEOD-63410 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the following subset Series: GSE19396: ETV1 knockdown in GIST cell lines GSE22433: Imatinib Treatment of GIST882 GSE22441: Mapping of ETV1 genomic binding sites in gastrointestinal stromal tumor (GIST). Refer to individual Series
2010-10-14 | E-GEOD-22852 | biostudies-arrayexpress