Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

13 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression profiling of prostate cancer cells upon JMJD2A or ETV1 knockdown

ABSTRACT: Gene expression profiling of LNCaP prostate cancer cells that have JMJD2A knockdown (JMJD2A shRNA #3; JMJD2A shRNA #5) or ETV knockdown (ETV shRNA #1; ETC shRNA #5) were compared to non-targeted control (sh-cm) cells. Total RNA was isolated from transformed LNCaP human prostate cancer cells containing a non-trageting control vector (sh-cm), vectors containing shRNA sequences for JMJD2A or ETV1 genes.

ORGANISM(S): Homo sapiens

SUBMITTER: Bart Frank

PROVIDER: E-GEOD-47750 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Gene expression profiling of prostate cancer cells upon JMJD2A or ETV1 knockdown

Project description:Gene expression profiling of LNCaP prostate cancer cells that have JMJD2A knockdown (JMJD2A shRNA #3; JMJD2A shRNA #5) or ETV knockdown (ETV shRNA #1; ETC shRNA #5) were compared to non-targeted control (sh-cm) cells.

2014-01-01 | GSE47750 | GEO

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

Project description:Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq. To determine ETV1 and H3K4me1 localization, logarithmically growing cells

2013-06-13 | E-GEOD-47120 | biostudies-arrayexpress

JMJD2A ChIP-chip from HEK293T cells

Project description:JMJD2A was chromatin immunoprecipitated from HEK293T cells overexpressing GFP-JMJD2A. From Van Rechem et al. 2011 JBC

2013-08-01 | GSE48765 | GEO

JMJD2A ChIP-chip from HEK293T cells

Project description:JMJD2A was chromatin immunoprecipitated from HEK293T cells overexpressing GFP-JMJD2A. From Van Rechem et al. 2011 JBC Determination of JMJD2A binding sites by MA2C analysis

2013-08-01 | E-GEOD-48765 | biostudies-arrayexpress

Identification of Jmjd2a KO regulated genes in the mouse hearts

2021-09-26 | GSE169645 | GEO

ChIP-Seq of Jmjd2a and Jmjd2c in B220+ B cells

Project description:Here we reported the Jmjd2a and Jmjd2c are co-targeted at the essential genes of mouse activating B220+ B cells. B cell activation programs transcription networks that subsequently induce plasma cell differentiation, but how histone demethylases participating in this process remains elusive. We found that histone demethylases Jmjd2a and Jmjd2c are expressed in Tfh-mediated signals stimulated mouse spelenic B220+ B cells. we then perform ChIP-seq by using anti-Jmjd2a and anti-Jmjd2c antibodies to identified the genes regulated by Jmjd2a and Jmjd2c and required for correct activation.

2020-01-01 | GSE99365 | GEO

Expression data of Jmjd2a and Jmjd2c-regulated genes in plasma cell differentiation

Project description:Base on the privious studie from our lab, we found the histone demethylases, Jmjd2a and Jmjd2c are upregulated in stimulated primary B cells, depletion of Jmjd2a and Jmjd2c in stimulated B cells resulted in failed activation of B cells. Owimg to the essential functions of Jmjd2a and Jmjd2c, We here applied loss of function approach, such as siRNA, to study the how Jmjd2a and Jmjd2c regulate plasma cell differentiation.

2020-01-01 | GSE99750 | GEO

Gene expression profiling of prostate cells with CHD1 knockdown

Project description:Gene expression profiling of prostate tumor cells comparing cells that have CHD1 knockdown by shRNA (RWPE-1, OPCN2) or siRNA (LNCaP) with cells treated with non-targeted control. Prostate cell lines had CHD1 knockdown via shRNA or siRNA were hybridized against cells that were targeted with non-targeting control. OPCN2 and RWPE-1 RNA were dye-swapped in replicate experiments.

2011-12-19 | E-GEOD-33531 | biostudies-arrayexpress

Microarray analysis of heart gene expression in wild type and JMJD2A heart specific transgenic mice after sham and thoracic aortic constriction surgery

Project description:Cardiac hypertrophy and failure are accompanied by a reprogramming of gene expression that involves transcription factors and chromatin remodeling enzymes. Little is known about the role of histone methylation and demethylation in this process. To understand the role of JMJD2A, a trimethyl demethylase for histone 3 lysine 9 and 36, in cardiac hypertrophy, we generated heart specific JMJD2A deletion (JMJD2A hKO) and overexpression (JMJD2A-Tg) mouse lines. JMJD2A hKO and JMJD2A-Tg mice are viable and have no overt baseline phenotype. However, they have altered responses to cardiac stresses. While inactivation of JMJD2A in hKO mice resulted in an attenuated hypertrophic response to transverse aortic constriction (TAC)-induced pressure overload compared to that of control littermates, JMJD2A-Tg mice have exacerbated cardiac hypertrophy after TAC. We identified four-and-a-half LIM domains 1 (FHL1) as a novel target of JMJD2A. JMJD2A binds to the FHL1 promoter in response to TAC and upregulates the expression of FHL1. Binding of JMJD2A to the FHL1 promoter is associated with downregulation of trimethylated H3K9. Upregulation of FHL1 by JMJD2A is mediated through SRF and myocardin, and requires its demethylase activity. The expression of JMJD2A is upregulated in human hypertrophic cardiomyopathy patients. Our studies reveal that JMJD2A promotes cardiac hypertrophy by synergistically upregulating SRF/myocardin-targeted genes and suggest a novel mechanism of reprogramming of gene expression involved in cardiac hypertrophy.

2011-06-02 | GSE27689 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data