Gene expression profiling of FFPE breast cancer samples [Affymetrix vs. Illumina]
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Maurizio Callari
PROVIDER: E-GEOD-51452 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:The use of Affymetrix U133 2.0 Plus chips on FFPE samples when coupled with a qPCR-based sample pre-assessment step, yielded satisfactory results from the point of view of biological reliability. When compared with the Illumina DASL WG platform, specifically designed for degraded RNA, the data generated with the Affymetrix platform showed a wider interquartile range (1.32 vs 0.57, p<2.2x10-16) suggesting a superior discriminatory power within samples as indicated by the good agreement with the immunohistiochemically derived ER status. FFPE primary breast cancer samples profiled using Illumina DASL WG platform after RNA amplification with the Nugen WT-Ovation FFPE System The following criteria were considered for a direct comparison of 12 GEPs obtained from Affymetrix and DASL platforms: gene variability as defined by IQR, ESR1 expression in ER status subgroups defined by IHC, distribution of fold changes for predefined ER related genes when comparing ER positive and negative samples.
2015-02-25 | E-GEOD-51451 | biostudies-arrayexpress
Project description:The enhancer/promoter of the vitellogenin II (VTG) gene has been extensively studied as a model system of vertebrate transcriptional control. While deletion mutagenesis and in vivo footprinting identified the transcription factor (TF) binding sites governing its tissue specificity, DNase hypersensitivity- and DNA methylation studies revealed the epigenetic changes accompanying its hormone-dependent activation. Moreover, upon induction with estrogen (E2), the region flanking the estrogen-responsive element (ERE) was reported to undergo active DNA demethylation. We now show that although the VTG ERE is methylated in embryonic chicken liver and in LMH/2A hepatocytes, its induction by E2 was not accompanied by extensive demethylation. In contrast, E2 failed to activate a VTG enhancer/promoter-controlled luciferase reporter gene methylated by SssI. Surprisingly, this inducibility difference could be traced not to the ERE, but rather to a single CpG in an E-box (CACGTG) sequence upstream of the VTG TATA box, which is unmethylated in vivo, but methylated by SssI. We demonstrate that this E-box binds the upstream stimulating factor USF1/2. Selective methylation of the CpG within this binding site with an E-box-specific DNA methyltranferase Eco72IM was sufficient to attenuate USF1/2 binding in vitro and abolish the hormone-induced transcription of the VTG gene in the reporter system.
2020-05-27 | PXD015594 | Pride
Project description:Analysis of gene expression of 23 T1 or T3 clear-cell renal cell carcinoma samples. Unsupervised clustering divided this group into three clusters, two of them contained pure T1 or T3 samples while one contained a mixed group. We defined a group of 35 genes that discriminate the mixed cluster. This gene set could be associated with tumor classification into a higher stage and it contained significant number of genes coding for molecular transporters, channel and transmembrane proteins.
2019-05-04 | E-MTAB-6118 | biostudies-arrayexpress
Project description:The liver-specific microRNA, miR-122, is an essential host factor for replication of hepatitis C virus (HCV), an important infectious cause of chronic liver disease and hepatocellular carcinoma. miR-122 stabilizes the positive-strand HCV RNA genome and promotes viral RNA synthesis by binding two closely spaced sites (S1 and S2) near the 5’ end of the genome in association with Ago2. Ago2 is essential for both host factor activities, but whether other host proteins are involved is unknown. Using a quantitative proteomics approach, we identified TNRC6A (GW182) and its paralogs (TNRC6B and TNRC6C), as functionally important components of the miR-122/Ago2 host factor complex binding HCV RNA. Depletion of any two TNRC6 proteins reduced HCV replication in Huh-7.5 cells,but did not reduce viral RNA stability or translational activity, but rather dampened miR-122 stimulation of viral RNA synthesis. However, TNRC6 depletion had no effect on replication of HCV in which S2 was mutated so that miR-122 binds only S1, whereas it significantly enhanced replication when S1 was mutated and only S2 bound by miR-122. Consistent with this, we found that TNRC6 proteins preferentially associate with the S1 site, and that the association of Ago2 with S2 is increased in TNRC6-depleted cells. Collectively, these data suggest a model in which TNRC6 proteins, which are known to interact with Ago2, preferentially direct the miR-122/Ago2 complex to S1 while restricting its association with S2, thereby fine tuning the spatial organization of miR-122/Ago2 complexes bound to the viral RNA.
2019-04-24 | PXD013054 | Pride
Project description:The interaction between transcription factors and genomic DNA forms the basis for spatio-temporal control of gene expression. Therefore, these interactions and their impact on disease and cellular fate are extensively studied on a global level, mainly using techniques based on next-generation sequencing. These techniques, however, do not allow an unbiased study of proteins or entire protein complexes that bind to a certain DNA sequence. In recent years, DNA pull-downs followed by quantitative mass spectrometry were introduced to close this gap. Established protocols, however, are based on metabolic labeling techniques or require enormous amounts of cellular material, thus restricting the method to cell lines grown in culture. Furthermore, they require substantial amount of expertise, thus keeping this technique restricted to a limited number of laboratories. Here, we introduce a high-throughput compatible, LC-MS/MS based DNA pull-down that combines on-bead digestion with direct dimethyl labeling or label-free protein quantification. We demonstrate, that our method can efficiently identify transcription factors binding to their known consensus DNA motifs when using nuclear extracts from model cell lines. Subsequently, we apply the method to study DNA-protein interactions in primary foreskin fibroblasts and peripheral blood mononuclear cells (PBMCs) freshly isolated from human donors. We show that the same DNA sequence binds different sets of proteins in an established model cell line as opposed to PBMCs. This stresses the importance of selecting relevant cell extracts for any interaction in question. In-depth nuclear proteomes with absolute quantification of close to 7,000 proteins in K562 cells and PBMCs clearly link these differential interactions to differences in protein abundance. In conclusion, our approach, applicable to primary material and capable of profiling DNA-protein interactions in high-throughput, will likely prove itself as a useful screening platform and will provide invaluable functional data, for example through integration with large scale GWAS.
2015-01-05 | PXD000782 | Pride
Project description:Diffuse gliomas represent the most prevalent class of primary brain tumor. Despite significant recent advances in the understanding of glioblastoma (WHO IV), its most malignant subtype, lower-grade (WHO II and III) glioma variants remain comparatively understudied, especially in light of their notably variable clinical behavior. To examine the foundations of this heterogeneity, we performed multidimensional molecular profiling, including global transcriptional analysis, on 101 lower-grade diffuse astrocytic gliomas collected at our own institution, and validated our findings using publically available gene expression and copy number data from large independent patient cohorts. We found that IDH mutational status delineated molecularly and clinically distinct glioma subsets, with IDH mutant (IDH mt) tumors exhibiting TP53 mutations, PDGFRA overexpression, and prolonged survival, and IDH wild-type (IDH wt) tumors exhibiting EGFR amplification, PTEN loss, and unfavorable disease outcome. Furthermore, global expression profiling revealed three robust molecular subclasses within lower-grade diffuse astrocytic gliomas, two of which were predominantly IDH mt and one almost entirely IDH wt. IDH mt subclasses were distinguished from each other on the basis of TP53 mutations, DNA copy number abnormalities, and links to distinct stages of neurogenesis in the subventricular zone (SVZ). This latter finding implicates discrete pools of neuroglial progenitors as cells of origin for the different subclasses of IDH mt tumors. In summary, we have elucidated molecularly distinct subclasses of lower-grade diffuse astrocytic glioma that dictate clinical behavior and demonstrate fundamental associations with both IDH mutational status and neuroglial developmental stage. 80 tumor samples, one normal tissue sample (brain)
2012-02-24 | E-GEOD-35158 | biostudies-arrayexpress
Project description:BANC-seq (Binding Affinities to Native Chromatin by sequencing) allows determination of absolute apparent binding affinites of transcription factors to native chromatin in a genome-wide manner. In this study, we establish the method and show that chromatin and DNA sequence define binding affinites of FOXA1, SP1, YY1 and MYC/MAX complex. To relate the identified binding affinities to the actual transcriptional levels of these transcription factors in the cells used in this study, and to confirm that the nuclear isolation protocol used in the study does not lead to loss of nuclear proteins, we have generated whole proteomes including proteomics standards for absolute quantification of proteins. In addition, to validate some of the findings of the study, we have performed PAQMAN (Protein-nucleic acid affinity quantification by MAss spectrometry in nuclear extracts), as well as DNA pulldowns followed by mass spec.
2023-02-09 | PXD038502 | Pride
Project description:The use of Affymetrix U133 2.0 Plus chips on FFPE samples when coupled with a qPCR-based sample pre-assessment step, yielded satisfactory results from the point of view of biological reliability. When compared with the Illumina DASL WG platform, specifically designed for degraded RNA, the data generated with the Affymetrix platform showed a wider interquartile range (IQR 1.32 vs 0.57, p<2.2x10-16) suggesting a superior discriminatory power within samples as indicated by the good agreement with the immunohistiochemically derived ER status. FFPE primary breast cancer samples profiled using Affymetrix HG-U133 Plus 2.0 microarray platform after RNA amplification with the Nugen WT-Ovation FFPE System The following criteria were considered for a direct comparison of 12 GEPs obtained from Affymetrix and DASL platforms: gene variability as defined by IQR, ESR1 expression in ER status subgroups defined by IHC, distribution of fold changes for predefined ER related genes when comparing ER positive and negative samples.
2015-02-25 | E-GEOD-51450 | biostudies-arrayexpress
Project description:Raw mass spec files for the protein interactomes of MALAT1, polyadenylated RNA, and scrambled controls in mouse liver and patient derived prostate tumor xenografts XG147 and XG77 as determined by HyPR-MS.
2023-07-30 | PXD038809 | Pride
Project description:Background: Metastases to the brain from breast cancer have a high mortality. Basal-like and HER2 positive breast cancers appear to have a high propensity to spread to the brain. The mechanisms that allow cells to colonise the brain are unclear. Methods: We have analysed matched and unpaired samples of breast cancer and brain metastases using morphology, immunophenotype and expression profiling and validated the data using in vitro cell culturing models and in vivo mice model. Results: Most of the brain metastases were triple negative and had a basal-like phenotype. Metastatic cells to the brain over-expressed HER3 compared to primaries and showed evidence of higher activation of the MAPK pathways. Inhibition using anti-neuregulin antibody, Herceptin and Lapatinib reduced tumour growth in vitro and in vivo. Conclusions: The data demonstrate activation of neuregulin-HER3 pathway in brain metastases from breast cancer and suggest that even in absence of HER2 amplification (as with triple negative and basal cancers), anti-epidermal growth factor receptor family inhibitors may have a role in treating these patients. An initial set of 29 matched pairs of primary breast cancer and their brain metastases and 22 unmatched brain metastases of from breast cancer was were available as formalin fixed-paraffin embedded (FFPE) tumor blocks. A second set of validation samples comprisinged of 10 matched pairs of primary breast cancer and their corresponding brain metastases and a further 11 non-breast metastatic brain cancers tumours fromn non-breast sites (one melanoma, six lung adenocarcinomas, one prostate carcinoma, one colon carcinoma and two renal cell carcinomas was also studied. After filtering DASL data on the first set of samples, 15/29 matched pairs and 22/22 unmatched metastases remained available for analysis for the initial set. In the second set all samples were analysed. RNA extraction and Real-Time RT-PCR Three 5μm thick FFPE sections of clinical samples, parental cell line MB-MDA-231 cell line (fixed in paraformoldehyde and embedded in paraffin) and intracranial mouse tumours were cut and de-waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA Paraffin Kit® (Roche Applied Science, Mannheim, Germany) according to the manufacturerâs protocol. RNA was quantified using the NanoDrop® ND-1000 (NanoDrop Technologies, DE, USA). RT-PCR for HER3 and housekeeping genes GAPDH and RPL13a was carried out using the Rotor-gene system (Corbett Life Science, Australia). Complementary DNA (cDNA) was synthesized from 240ng of total RNA using oligodT16 primers and the SuperScriptTM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). A standard curve for gene expression of HER3 and GAPDH and RPL13a was constructed using total RNA from a human breast cancer cell line (SKBR-3). Replicates of 10-fold dilutions of RNA in water were made to give 3 different calibrators, each with a known amount of SKBR-3 RNA for which arbitrary copy number were given. The PCR conditions were: 50°C for 2 minutes, 95°C for 2 minutes, followed by 40 cycles with the following profile: denaturation at 95°C for 20 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 20 seconds. Flourescent incorporation was acquired in the green channel during the 72°C incubations. Intron spanning primer sequences were: GAPDH (5âCTGCACCACCAACTGCTTAG3â, 5âGTCTTCTGGGTGGCA GTGAT3â), RPL13a (5âGTTGGTGTTCATCCGTTG3â, 5âGTACGCTGTGAAGCATCAA3â), HER3 (5âTGGTTCATGGGCATGTATCC3â, 5âCTAGACCTAAGACTTGGAGC3â). DASL gene expression profilingGene expression profiling was performed using the DASL assay (cDNA-mediated annealing, selection extension and ligation, Illumina Inc., California, USA) interrogating the DASL Cancer Panel that contained 512 cancer related genes. The first and second sets of samples were analyzed in two independent experiments. Tumours arising from the animal experiment were analyzed in conjunction with the second set of clinical samples. All protocols were as specified by Illumina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo-d(T)18 and random nonamers. Oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylated cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non-hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. These products were subjected to PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted using BeadStudio software (Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Probes with a BeadStudio detection score greater than 0.99 in more than 15 conditions were included. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in Genespring® version 7.0 software (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using: Similarity measure; Pearson Correlation and clustering algorithm; Average Linkage. Genes differentially expressed between primary tumors and brain metastases were identified using analysis of variance (ANOVA, p<0.01) or parametric test, variances not assumed equal (Welch t-test, p < 0.005). Up and down regulation was considered for normalized data values that were greater or less than a factor of 2 fold for the conditions compared.
2010-06-24 | E-GEOD-14683 | biostudies-arrayexpress