Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

11 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Global analysis of p53-regulated transcription reveals its direct targets and unexpected regulatory mechanisms (GRO-Seq)

ABSTRACT: GRO-seq of HCT116 cells treated with Nutlin to activate p53 HCT116 cells were treated with Nutlin or DMSO for 1 hour

ORGANISM(S): Homo sapiens

SUBMITTER: Mary Allen

PROVIDER: E-GEOD-53964 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms.

Allen Mary Ann MA Andrysik Zdenek Z Dengler Veronica L VL Mellert Hestia S HS Guarnieri Anna A Freeman Justin A JA Sullivan Kelly D KD Galbraith Matthew D MD Luo Xin X Kraus W Lee WL Dowell Robin D RD Espinosa Joaquin M JM

eLife 20140527

The p53 transcription factor is a potent suppressor of tumor growth. We report here an analysis of its direct transcriptional program using Global Run-On sequencing (GRO-seq). Shortly after MDM2 inhibition by Nutlin-3, low levels of p53 rapidly activate ∼200 genes, most of them not previously established as direct targets. This immediate response involves all canonical p53 effector pathways, including apoptosis. Comparative global analysis of RNA synthesis vs steady state levels revealed that mi ...[more]

PMID: 24867637

Similar Datasets

Analysis of p53 target genes in melanoma

Project description:This SuperSeries is composed of the following subset Series: GSE29359: Analysis of p53 target genes in melanoma part 1 GSE29361: Analysis of p53 target genes in melanoma part 2 Refer to individual Series

2011-12-01 | E-GEOD-29377 | biostudies-arrayexpress

mRNA-seq analysis of HCT116 cells following gene overexpression of IDO1 with or without Indole treatment

Project description:To investigate the effect of indole on protection against colon injury and the role of IDO1 expression, we examined the effect of indole on hIDO1-overexpressing and empty vector control HCT116 cells by global gene expression profiling. Examination of mRNA levels from hIDO1-overexpressing and control HCT116 cell lines treated with 1mM indole or DMF for 24 hours using two replicates each.

2016-07-01 | E-GEOD-83939 | biostudies-arrayexpress

Analysis of p53 target genes in melanoma part 2

Project description:Although mutations in p53 are infrequent in human melanoma, its function is abnormal. In this study, whole genome bead arrays were used to examine the expression of p53 target genes in extracts from 6 melanoma cell lines, compared to extracts derived from diploid human melanocytes and fibroblasts, to provide a global assessment of aberrant p53 function. The expression of these genes was also examined in extracts derived from melanocytes and melanoma cell lines in which p53 expression had been inhibited using shRNA and compared to cells that had been transduced with a control shRNA. Total RNA extracted from 18 samples was analysed representing duplicates of 6 melanoma cell lines, 1 melanocyte cell line and 2 fibroblast cell lines. Melanoma cell lines were compared to normal cell lines. In addition, IgR3, Mel-RM and melanocyte cell lines were transduced with either control shRNA or p53 shRNA to evaluate the effect of p53 on its target genes. Cell lines transduced with control shRNA were compared to cell lines transduced with p53shRNA. Duplicates were analysed.

2011-12-01 | E-GEOD-29361 | biostudies-arrayexpress

Analysis of p53 target genes in melanoma part 1

2011-12-01 | E-GEOD-29359 | biostudies-arrayexpress

Integrative Genomic Analysis Reveals Widespread Enhancer Regulation by p53 in Response to DNA Damage

Project description:The tumor suppressor p53 has been studied extensively as a direct transcriptional activator of protein-coding genes. Recent studies, however, have shed light on novel regulatory functions of p53 within noncoding regions of the genome. Here, we use a systematic approach that integrates transcriptome-wide differential expression analysis, genome-wide p53 binding profiles, chromatin state maps, and additional genomic features to characterize the global regulatory roles of p53 in response to DNA damage in both human and mouse fibroblast models. In addition to known p53 targets, we identify many previously unappreciated mRNAs and long noncoding RNAs that are regulated by p53. Moreover, we find that p53 binding events occur predominantly within enhancer elements in both human and mouse systems. The ability to modulate enhancer activity offers an additional layer of complexity to the p53 network and greatly expands the diversity of genomic elements that are directly regulated by p53. Human and Mouse fibroblasts cultured in the presence or absence of doxorubicin followed by RNA-Seq (Human:2 cell lines, each condition in duplicate; Mouse:MEF cell line,each condition in triplicate) and p53 ChIP-Seq (Human:2 cell lines, input and IP for each; Mouse:MEF cell line, input and IP)

2015-04-18 | E-GEOD-55727 | biostudies-arrayexpress

RNA Capture-Seq resolves the deep complexity of the human transcriptome (Illumina)

Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic gene deserts. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/

2011-09-12 | E-GEOD-29038 | biostudies-arrayexpress

Dynamic changes in E protein activity orchestrate germinal center and plasma cell development [ChIP-Seq]

Project description:Humoral immunity requires the generation of high-affinity antibodies, which involves the generation of germinal centres (GC) promoting class switch and affinity maturation of antigen-specific B cells, and the differentiation of long-lived plasma cells. This multi-layered process is tightly controlled by the activity of a transcriptional network including Bcl6, essential for the development of GC, and Blimp1, required for the differentiation of plasma cells. Here, we reveal an additional layer of complexity by demonstrating that dynamic changes in E-protein activity mediated by Id3 govern both GC and plasma cell differentiation. We show that down-regulation of Id3 expression in B cells in essential for releasing E2A and E2-2, the combined activity of which is required for both GC B cell and plasma cell differentiation. We demonstrate that this pathway controls the expression of multiple key factors required for antigen-induced B cell differentiation, including Blimp1, Xbp1, Mef2b and CXCR4 and is therefore critical for establishing the transcriptional network that controls GC B cell and plasma cell differentiation. Genome binding of transcription factor E2A

2016-05-13 | E-GEOD-72828 | biostudies-arrayexpress

FOXM1 Cistrome Predicts Breast Cancer Metastatic Outcome Better Than FOXM1 Expression Levels or Tumor Proliferation Index [RNA-Seq]

Project description:FOXM1 is a key transcription factor regulating cell cycle progression, DNA damage response, and a host of other hallmark cancer features, but the role of the FOXM1 cistrome in driving estrogen receptor-positive (ER+) vs. ER- breast cancer clinical outcomes remains undefined. Chromatin immunoprecipitation sequencing (ChIP-Seq) coupled with RNA sequencing (RNA-Seq) analyses was used to identify FOXM1 target genes in breast cancer cells (MCF-7) where FOXM1 expression was either induced by cell proliferation or repressed by p53 upregulation.

2015-10-26 | E-GEOD-73370 | biostudies-arrayexpress

Transcription factor p63 bookmarks genomic loci in epithelial cells and regulates a subset of target genes during epidermal differentiation through dynamic enhancers (RNA-Seq)

Project description:Tightly controlled gene expression orchestrated by the transcription factor p63 during epithelial differentiation is important for development of epithelial-related structures such as epidermis, limb and craniofacial regions. How p63 regulates spatial and temporal expression of its target genes during these developmental processes is however not yet clear. By epigenomics profiling in stem cells established from one of these epithelial structures, the epidermis, we provide a global map of p63-bound regulatory elements that are categorized as single enhancers and clustered enhancers during epidermal differentiation. Transcriptomics analysis shows dynamic gene expression patterns during epidermal differentiation that correlates with the activity of p63-bound enhancers rather than with p63 binding itself. Only a subset of p63-bound enhancers is active in epidermal stem cells, and inactive p63-bound enhancers appear to function in gene regulation during the development of other epithelial tissues. Our data suggest a paradigm that p63 bookmarks genomic loci during the commitment of the epithelial lineage and regulates gene expression in different epithelial tissues through tissue-specific active enhancers. The catalogue of differentially expressed epidermal genes including non-coding RNAs and epithelial enhancers reported here provides a rich resource for studies of epithelial development and related diseases. Comparison of gene expression at different stages of keratinocyte differentiation

2015-05-01 | E-GEOD-59822 | biostudies-arrayexpress

Silencing RNA-binding protein CELF1 inhibits tumor growth and alters gene expression in oral squamous cell carcinoma

Project description:RNA-binding proteins (RBPs) are critical regulators of gene expression, but only a small fraction have been studied for their role in malignancy. Here we report a systematic analysis of RBP CUGBP Elav-Like Family member 1 (CELF1 alias CUGBP1) roles in mRNA alternative splicing, translation and turnover in oral cancer cells. CELF1 is overexpressed in carcinogen-induced oral cancer tumorigenesis mouse model and specific inhibition of CELF1 reduces tumor growth in vivo. Deep transcriptomic analysis revealed that hundreds of mRNAs were differentially regulated as a function of CELF1 expression in oral cancer cells. More importantly, the presence of CELF1 promoted alternative splicing of several target mRNAs which are known to be involved in various cancer biological processes. Using a pulse SILAC-based quantitative proteomic approach, we observed hundreds of proteins whose translation was controlled by CELF1 and those altered proteins were implicated in malignancy. Altogether, these data provided a comprehensive view of the CELF1 mRNA regulatory network in OSCC and suggests that CELF1 is a viable target for therapeutic intervention. Significance Post-transcriptional mechanisms that regulate cancer cells which are believed to constitute the driving force of many malignancies are poorly understood. We show that oral squamous cell carcinoma (OSCC) emerge as a result of an over expressed RNA-binding protein CELF1, a protein implicated in mRNA turnover, alternative splicing and translation. The resulting mRNA expression repertoire regulates networks of genes whose expression changes regulate oral cancer pathogenesis. Inhibition of CELF1 mitigated OSCC tumor-forming capacity and offers an attractive therapeutic option for oral malignancies. Transcriptomic analysis of UMSCC-74B oral cancer cells as a function of CELF1 protein expression.

2015-09-01 | E-GEOD-57254 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data