Early and late passage endothelial cells with or without PDCD10 downregulation
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Juan Zalvide
PROVIDER: E-GEOD-54095 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Stable knockdown of NET1, a RhoGEF, was achieved in AGS Gastric Cancer cells. This gene is known to be overexpressed in the disease. Knockdown was achieved using lentiviral shRNA particles. Gene expression was compared between knockdown and scrambled shRNA treated control cells. Cells were treated with and without LPA, a known activator of RhoA. Three distinct cell lines were used in this study (all AGS cells); (i) Non Target cell (NT) stably expressing non targetting shRNA (ii) 63 and (iii) 65; the latter two are stable NET1 knockdown cells and are seperatly transduced with separate NET1 targetting shRNA particles. Cells were treated with and without 10microM LPA for 4 hr. Experimental replicates were performed for each treatment (A & B), RNA was prepared from each and seperatly hybridised to U133A arrays.
2011-01-02 | E-GEOD-26309 | biostudies-arrayexpress
Project description:The discovery of cytosine hydroxymethylation (5-hmC) as a mechanism that potentially controls DNA methylation changes typical of neoplasia prompted us to investigate its behavior in colon cancer. 5-hmC is globally reduced in proliferating cells such as colon tumors and the gut crypt progenitors, from which tumors can arise. Here, we show that colorectal tumors and cancer cells express Ten-Eleven Translocation (TET) transcripts at levels similar to normal tissues. Genome-wide analyses show that promoters marked by 5-hmC in normal tissue, and those identified as TET2 targets in colorectal cancer cells, are resistant to methylation gain in cancer. In vitro studies of TET2 in cancer cells confirm that these promoters are resistant to methylation gain independently of sustained TET2 expression. We also find that a considerable number of the methylation gain-resistant promoters marked by 5-hmC in normal colon overlap with those that are marked with poised bivalent histone modifications in embryonic stem cells. Together our results indicate that promoters that acquire 5-hmC upon normal colon differentiation are innately resistant to neoplastic hypermethylation by mechanisms that do not require high levels of 5-hmC in tumors. Our study highlights the potential of cytosine modifications as biomarkers of cancerous cell proliferation. Six samples were analyzed. 2 biological replicates each of HCT116 cells stably transfected with an empty vector control (TET_KD_Plk), with shRNA to TET2 (TET_KD_2C) and with shRNA to TET2 and TET3 (TET_KD_2.3)
2015-02-03 | E-GEOD-63421 | biostudies-arrayexpress
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâs lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. BL2 Burkitt's lymphoma-derived B cells were infected with lentivirus expressing shRNA for IRF4 or control, and total RNA was subjected to Illumina BeadsExpression Arrays analysis.
2015-12-15 | E-GEOD-64269 | biostudies-arrayexpress
Project description:Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, SigmaM-bM-^@M-^SAldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (SigmaM-bM-^@M-^SAldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (SigmaM-bM-^@M-^SAldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturerM-bM-^@M-^Ys instructions. RNA samples from three independent experiments were used for microarray analysis.
2014-08-02 | E-GEOD-60003 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series
2015-02-03 | E-GEOD-47592 | biostudies-arrayexpress
Project description:To test whether or not the stable restoration of PMEL and FHL2 knockdown affects the oncogenic ability of into amelanotic melanoma cells. Global gene expression analysis performed to identify what different mechanisms and/or factors might be involved in cell motility and cell aggressiveness. A375M2 were stable transduced with lentivirus containing an empty vector expressing eGFP, full length PMEL or shRNA specific sequence against FHL2. Cells were FACS selected and grown in selective medium for 15 days before testing. Total RNA was extracted from cells after being seeded at equal numbers and reached 80% confluence. Samples were obtained from three separate experiments and send together for processing.
2015-04-11 | E-GEOD-57348 | biostudies-arrayexpress
Project description:Oral squamous cell carcinoma cell line Cal27 was transfected with lentiviral shIL-1beta or scrambled shRNA. We used microarrays to detail the global program of gene expression during this process. IL-1beta was identified as one of the key node genes in oral carainogenesis in our preveious in vitro study. This in vivo study was designed to confirm the role of IL-1 beta and explore some more detail about the evolvment of IL-1 in malignant transformation.
2016-05-17 | E-GEOD-70301 | biostudies-arrayexpress
Project description:Fanconi anemia (FA) is a genetic disorder characterized by congenital abnormalities, bone marrow failure and increased susceptibility to cancer. Of the fifteen FA proteins, Fanconi anemia group C (FANCC) is one of eight FA core complex components of the FA pathway. Unlike other FA core complex proteins, FANCC is mainly localized in the cytoplasm, where it is thought to function in apoptosis, redox regulation, cytokine signaling and other processes. Previously, we showed that regulation of FANCC involved proteolytic processing during apoptosis. To elucidate the biological significance of this proteolytic modification, we searched for molecular interacting partners of proteolytic FANCC fragments. Among the candidates obtained, the transcriptional corepressor protein C-terminal binding protein-1 (CtBP1) interacted directly with FANCC and other FA core complex proteins. Although not required for stability of the FA core complex or ubiquitin ligase activity, CtBP1 is essential for proliferation, cell survival and maintenance of chromosomal integrity. Expression profiling of CtBP1-depleted and FA-depleted cells revealed that several genes were commonly up- and down-regulated, including the Wnt antagonist Dickkopf-1 (DKK1). These findings suggest that FA and Wnt signaling via CtBP1 could share common effectors. HeLa cell line was grown in DMEM media supplemented with 10% FBS and were incubated in 5% CO2 at 37°C. A four-plasmid (pRSV-Rev, pMDLg/pRRE, pMD2.G and pLKO.1) expression system was used for lentiviral production. Different pLKO.1 plasmids carrying shRNAs targeting FANCA, FANCD2, CtBP1 or CtBP2 or a lentiviral control vector pLKO.1-scrambled were used. Lentiviral particles were produced via calcium phosphate-mediated transient transfection of the four plasmids into HEK293T cells. Cells were exposed to appropriate lentiviral particles. In each experiment, HeLa cells were transduced for 6 hours with filtered supernatant containing recombinant lentiviral particles. After transduction, the cells were cultured for 72 hours. Total RNA extracts from 3 different samples of each scrambled, CtBPs and FANCD2 shRNA treated HeLa cells were subjected to gene expression profiling via microarray analysis. Gene expression profiles were determined with Affymetrix GeneChip® Human Gene 1.0.
2013-04-05 | E-GEOD-43330 | biostudies-arrayexpress
Project description:Developmental checkpoints in stem/progenitor cells are critical to the determination, commitment and differentiation into distinct lineages. Cancer cells often retain expression of lineage-specific checkpoint proteins, but their potential impact in cancer remains elusive. T lymphocytes mature in the thymus following a highly orchestrated developmental process that entails the successive rearrangements and expression of T-cell receptor (TCR) genes. Low affinity recognition of self-peptide/MHC complexes (self-pMHC) presented by thymic epithelial cells by the TCR of CD4+CD8+ (DP) cortical thymocytes transduces positive selection signals that ultimately shape the developing T cell repertoire. DP thymocytes not receiving these signals die by lack of stimulation whereas those that recognize self-pMHC with high affinity undergo TCR-mediated apoptosis and negative selection. In T-cell acute lymphoblastic leukaemia (T-ALL), leukaemic transformation of maturating thymocytes results from the acquisition of multiple genetic and epigenetic alterations in oncogenes and tumour suppressor genes, that disrupt the normal regulatory circuits and drive clonal expansion of differentiation-arrested lymphoblasts. We show here that TCR triggering by negatively-selecting self-pMHC prevented T-ALL development and leukaemia maintenance in mice. Induction of TCR signalling by high affinity self-pMHC or treatment with monoclonal antibodies to the CD3 signalling chain (anti-CD3) caused massive leukaemic cell death and a gene expression program resembling that of thymocyte negative selection. Importantly, anti-CD3 treatment hampered leukaemogenesis in mice transplanted with either mouse or patient-derived T-ALLs. These data provide a rationale for targeted therapy based on anti-CD3 treatment of T-ALL patients and demonstrate that endogenous developmental checkpoint proteins are amenable to therapeutic intervention in cancer cells. Gene expression data from four culture conditions was performed for the following cells: ALL-SIL-TCRα/β-GFP co-cultured on OP9-DL1 for 48 h, ALL-SIL-TCRα/β-GFP without co-culture, ALL-SIL cells transduced with TLX shRNA (sh-TLX), and ALL-SIL transduced with sh-control vectors. All conditions are performed in two replicates.
2016-08-20 | E-GEOD-65496 | biostudies-arrayexpress
Project description:We identify Pax3 and Pax9 transcription factors (TFs) as important regulators of mouse heterochromatin. Simultaneous depletion of these factors results in loss of H3K9me3 from Major Satellite repeats and dramatic transcript overexpression. H3K9me3 enrichment at intergenic major satellite repeats is only present if these sequences retain intact Pax and other TF binding sites. H3K9me3 ChIP-seq in mouse ES cells wt and Pax3 KO and Pax3 KO/Pax9 KD
2012-09-16 | E-GEOD-40086 | biostudies-arrayexpress