Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcription profiling of Arabidopsis with post-transcriptionally silenced Myosin XI-K

ABSTRACT: This study was aimed to determine roles of individual myosins in organelle trafficking in plant cell. Expression of Myosin XI-K was suppressed in transgenic A.thaliana by using RNAi approach. To ensure that the RNAi-induced gene silencing was specific and did not affect expression of other myosins, a microarray analysis was performed. Experiment Overall Design: Total RNA was purified from A.thaliana plants transformed with an inverted repeat construct harbouring a sequence derived from Myosin XI-K ORF. 3 independent groups of plants were used for comparison of the expression profiles of 17 myosin RNAs to a control group comprised of plants constitutively expressing GUS ORF as a transgene.

ORGANISM(S): Arabidopsis thaliana

SUBMITTER: Valera Peremyslov

PROVIDER: E-GEOD-5431 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Expression profiling of A.thaliana with the posttranscriptionally silenced Myosin XI-K

Project description:This study was aimed to determine roles of individual myosins in organelle trafficking in plant cell. Expression of Myosin XI-K was suppressed in transgenic A.thaliana by using RNAi approach. To ensure that the RNAi-induced gene silencing was specific and did not affect expression of other myosins, a microarray analysis was performed. Keywords: RNAi-mediated posttranscriptional gene silencing, Myosin expression levels

2006-08-04 | GSE5431 | GEO

The Class VIII myosin ATM1 is integral for root apical meristem function

Project description:Myosins are evolutionarily conserved motor proteins that interact with actin filaments to regulate organelle transport, cytoplasmic streaming and cell growth. Plant specific Class XI myosin proteins direct cell division and root organogenesis. However, the roles of Class VIII myosin proteins in plant growth and development are less understood. Here, we investigated the function of an auxin-regulated Class VIII myosin, Arabidopsis thaliana Myosin 1 (ATM1), using genetics and live cell microscopy. ATM1 is a plasmodesmata-localized protein that is enriched in actively dividing cells in the root apical meristem (RAM). Loss of ATM1 function results in impaired primary root growth due to decreased RAM size and reduced cell proliferation in a sugar dependent manner. Examination of stem cell marker line expression in atm1-1 indicated impaired division of the lateral root cap and columella cells and a diminished auxin response. Transcriptome analysis of atm1-1 linked these growth defects to dysregulation of cell cycle and auxin pathway genes. Complementation of ATM1 loss-of- function mutant restored root growth and cell cycle progression in the root meristem. Collectively, these results provide novel evidence that ATM1 functions to influence cell proliferation and differentiation in primary roots in response to auxin and sugar cues.

2023-06-08 | GSE200917 | GEO

Arabidopsis thaliana

Project description:Expression profiling of A.thaliana with the posttranscriptionally silenced Myosin XI-K

| PRJNA96093 | ENA

RNP immunoprecipitation of fission yeast using Rng3p myosin-specific chaperones to investigate if the association of Rng3p with RNAs occurs on ribosomes

Project description:Ribonucleoprotein immunoprecipitation microarray (RIp-chip) study using the Rng3p myosin-specific chaperones from the fission Schizosaccaromyces pombe. Rng3p associates with RNAs encoding myosins. To investigate if the association of Rng3p with these RNAs occurs on ribosomes, Rng3-purified fractions were immunoprecipitated with antibodies against a ribosomal RNA or an unrelated antibody. The RNAs present in the second immunoprecipitate were analysed using DNA microarrays

2008-12-23 | E-TABM-564 | biostudies-arrayexpress

Search for the interactors of Arabidopsis thaliana myosin receptor MRF7

Project description:This project aims at identifying the binding partners of the Arabidopsis thaliana MRF7 protein and of its truncated form ΔMRF7, which lacks a potential protein binding domain DUF593 at the N-terminus. A.thaliana plants stably overexpressing GFP-MRF7 and GFP-ΔMRF7 were generated by ﬂoral dipping of Col-0 plants. Co-immunoprecipitation was carried out using the GFP-Trap®_A beads technology (Chromotek) and samples thus obtained were analysed through Liquid Chromatography-Mass Spectrometry

2022-02-17 | PXD027155 | Pride

Ribonucleoprotein immunoprecipitation of myosin proteins and myosin-specific chaperones in fission yeast

Project description:Ribonucleoprotein immunoprecipitation microarray (RIp-chip) study using various myosin proteins and myosin-specific chaperones from the fission Schizosaccaromyces pombe

2010-03-01 | E-TABM-335 | biostudies-arrayexpress

Ribonucleoprotein immunoprecipitation of fission yeast to study myosin proteins and myosin-specific chaperones

Project description:Ribonucleoprotein immunoprecipitation microarray (RIp-chip) study using various myosin proteins and myosin-specific chaperones from the fission Schizosaccaromyces pombe. Two strains were used. In rng3TAP the rng3 protein has been tagged with TAP to allow its detection and immunoprecipitation. The TAP strain expresses the TAP sequence alone (without being attached to an other protein)

2008-12-23 | E-TABM-516 | biostudies-arrayexpress

CRISPR-Cas9/phosphoproteomics identifies Myosin Light Chain Kinase dependent signaling in kidney epithelial cells

Project description:Prior studies have implicated myosin light chain kinase (MLCK) in the regulation of aqua-porin-2 (AQP2) in the renal collecting duct. To discover signaling targets of MLCK, we deleted the Mylk- gene to obtain MLCK-null mpkCCD cells and carried out comprehensive phosphopro-teomics using the SILAC method for quantification. Only 107 phosphopeptides were changed in abundance by MLCK deletion out of 1743 quantified over multiple replicates (29 decreased and 78 increased). One of the decreased phosphopeptides corresponded to the canonical target site in myosin regulatory light chain (MLC). Network analysis indicated that targeted phosphopro-teins clustered into distinct structural/functional groups: “acto-myosin,” “signaling,” “nuclear envelope,” “gene transcription,” “mRNA processing,” “energy metabolism,” “intermediate fila-ments,” “adherens junctions” and “tight junctions.” There was significant overlap between the derived MLCK signaling network and a previously determined PKA signaling network. Phalloidin labeling revealed that MLCK deletion inhibited the normal effect of vasopressin to depolymer-ize F-actin. Immunocytochemistry and electron microscopy demonstrated a defect in pro-cessing of early endosomes to late endosomes. In contrast, surface biotinylation studies showed no effect of MLCK deletion on AQP2 endocytosis. We conclude that MLCK is part of a multi-component signaling pathway that includes much more than simple regulation of conven-tional non-muscle myosins through MLC phosphorylation. Furthermore, vasopressin signaling in collecting duct cells involves both MLCK-dependent signaling and PKA-dependent signaling, which display significant overlap. Mapping MLCK targets revealed potential roles in both nu-cleus and cytoplasm. The latter includes proteins that regulate both actin polymerization and AQP2-endosomal processing from early to late endosomes.

2020-03-04 | PXD014985 | Pride

Transcriptomic analysis of myosin IIa-deficient B cells

Project description:Myosin IIa-deficient follicular B cells have a hyperactivated phenotype. To identify what pathways are regulated by myosin IIa, we performed RNA-seq of coding RNA on flow cytometry sorted follicular B cells from CD23Cre+Myh9fl/fl and CD23Cre+Myh9wt/fl mice.

2018-04-14 | GSE113114 | GEO

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

2023-12-18 | GSE202685 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data