Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture

ABSTRACT: Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

ORGANISM(S): Homo sapiens

SUBMITTER: Henriette O'Geen

PROVIDER: E-GEOD-61099 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture.

O'Geen Henriette H Henry Isabelle M IM Bhakta Mital S MS Meckler Joshua F JF Segal David J DJ

Nucleic acids research 20150220 6

Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of target site recognition. Cleavage specificity is typically evaluated by low throughput assays (T7 endonuclease I assay, target amplification followed by high-throughput sequencing), which are limited to a subset of potential off-target sites. Here, we used ChIP-seq to examine genome-wide C ...[more]

PMID: 25712100

Similar Datasets

Project description:Background: The CRISPR/Cas9 toolbox has recently been expanded to include approaches for modulating gene expression. To successfully build on this work, and apply it for answering biological questions, it is important to establish it in a broad range of circumstances. Genome-scale CRISPR interference (CRISPRi) has been used in human cells lines, however the rules for designing effective guide RNAs (gRNAs) in different organisms are not well known. We sought to determine rules that determine gRNA effectiveness at transcriptional repression in Saccharomyces cerevisiae. Results: We created an inducible single plasmid CRISPRi system for gene repression in yeast, and used it to analyze fitness effects of gRNAs under 18 small molecule treatments. Our approach correctly identified previously-described chemical-genetic interactions, as well as a new mechanism of suppressing fluconazole toxicity by repression of the ERG25 gene. Assessment of multiple target loci across treatments allowed us to determine generalizable features associated with gRNA efficacy. Guides that target regions with low nucleosome occupancy and high chromatin accessibility were clearly more effective. We also found the best region to target gRNAs was between the transcription start site (TSS) and 200bp upstream of the TSS. Finally, unlike nuclease-proficient Cas9 in human cells, point mutations were tolerated equally well by truncated (18 nt specificity sequence) and full length (20 nt) gRNAs, however, 18 nt gRNAs were generally less potent than full length gRNAs. Conclusions: Our results establish a powerful functional genomics screening method, provide rules for designing effective gRNAs for gene repression, and show that 18 nt and 20 nt gRNAs exhibit similar tolerance to mismatches in the target sequence. These findings will enable effective library design and genome-wide screening in many genetic backgrounds. An expression construct was created for inducible CRISPRi in yeast. Key features include ORFs expressing dCas9-Mxi1 and the tetracycline repressor (TetR), as well as a tetracycline inducible gRNA locus containing the RPR1 promoter with a TetO site, a NotI site for cloning new gRNA specificity sequences, and the constant part of the gRNA. When yeast containing this plasmid are grown in the absence of anhydrotetracycline (ATc) TetR binds the gRNA promoter and prevents PolIII from binding and transcribing the gRNA. This in turn prevents dCas9-Mxi1 from binding the target site. In the presence of ATc, TetR dissociates and gRNA is expressed, allowing dCas9-Mxi1 to bind its target locus, and repress gene expression. gRNA libraries were cloned into this construct and transformed into yeast to create pools. Experiments were conducted in which yeast pools were grown in inducing (+ATc) and non-inducing conditions (-ATc) in the presence of different drugs. After multiple generations of growth in these conditions, yeast plasmids were minipreped and the gRNA locus was PCRed and sequenced via MiSeq. Counts of each gRNA were compared in different conditions.

Project description:To study target sequence specificity, selectivity, and reaction kinetics of Streptococcus pyogenes Cas9 activity, we challenged libraries of random variant targets with purified Cas9::guide RNA complexes in vitro. Cleavage kinetics were nonlinear, with a burst of initial activity followed by slower sustained cleavage. Consistent with other recent analyses of Cas9 sequence specificity, we observe considerable (albeit incomplete) impairment of cleavage for targets mutated in the PAM sequence or in "seed" sequences matching the proximal 8 bp of the guide. A second target region requiring close homology was located at the other end of the guide::target duplex (positions 13-18 relative to the PAM). Strikingly, a subset of variants which broke homology in the intervening region consistently increased the capacity of Cas9 to cleave in extended reactions. Sequences flanking the guide+PAM region had measurable (albeit modest) effects on cleavage. Taken together, these studies provide both a basis for predicting effective cleavage targets and a basis for potential optimization of guide RNAs to yield efficiency beyond that of the simple perfect-match guides. 118 samples anaylzed. Controls have con in sample name. To quantitatively measure cleavage efficiency of a single gRNA, we created a population of random variant target sequences to two gRNA targets. The targets used were "unc-22A", [a sequence from the well-characterized unc-22 gene of Caenorhabditis elegans], and "protospacer 4" (ps4), a previously characterized sequence from a natural spacer from S. pyogenes MGAS10750 . Using custom mixtures of oligonucleotide precursors for each base during chemical synthesis, a set of polymorphic target libraries ('Random Variant Libraries') were designed to have a baseline variation rate at each position. On each side of the gRNA homology and PAM regions, 6 bps of random sequence were added. The first base of intended gRNA homology is designated base 1 . The entire 35 bp random variant library mixture was cloned into a standard plasmid vector (pHRL-TK). Several thousand colonies from plates were washed in pools and prepared by standard plasmid preparation methods. The complexity of the libraries were estimated based on Illumina sequencing of the uncut libraries and filtering for minimum representation expected from the pooling. Approximately 1500-3000 unique species were obtained in the unc-22A libraries and 5000 unique sequences in the ps4 library (see Materials and Methods). To assay cleavage, purified Cas9 was first incubated with gRNA, followed by incubation with the variant library for various time points and under various conditions. DNA template is among the conditions varied in the experiments. After protein removal, flanking sequences outside of the target region are used for PCR amplification and plasmid cleavage was measured through loss of PCR products that span the region of interest. A set of perfectly matched targets and highly mutated versions present in the random variant library served as internal positive and negative controls respectively. A log retention score for each sequence in each experiment was calculated by quantifying the representation of each sequence before and after addition of the Cas9 protein. Two approaches were used for normalization: first we used a population of ps4 targets "spiked" into the library as an uncleaved control, second, we used a population of unc-22A targets with large numbers of variations from the perfect target (between 4 and 7), and hence likely limited if any cleavage. Equivalent results are obtained with these two normalization approaches (see Computational Methods for details). Retention scores are expressed as the log2 of the normalized ratio, so that a more negative retention score indicates efficient cleavage of substrate while a less negative score indicates less cleavage. Templates which are uncleaved will yield a retention score at or near zero. Comparisons between multiple experiments indicate strong correlation between independent retention measurements. GSM1410678-GSM1410761; AF_SOL*.dat' files contain the calculated final retentions for each experiment. Each experiment labeled: M-bM-^@M-^\AF_SOL_###_t###M-bM-^@M-^]. M-bM-^@M-^\AF_SOL_###M-bM-^@M-^] corresponds to the experiment run ID and M-bM-^@M-^\t###M-bM-^@M-^] corresponds to the incubation time of the experiment. For example AF_SOL_513_t360, corresponds to experiment 513 on the protospacer 4 guide and DNA target and the incubation time was 360 mins. The experimental conditions and ID can be found in the associated publication. GSM1544297-GSM1544332; unc*.dat file is a tab-delimited file of all considered sequences in each experiment. The names of the files and the AF_SOL_# run number can be found in the associated publication (Supplementary Materials) with the details of the conditions. Each filename starts with the type of gRNA used (either unc-22WT or the mutant version unc22C11G). The next number (#min) is indication of the time of incubation for the experiment and this is either followed by #pcr_AF_SOL_# or just AF_SOL_#. If followed by #pcr, that is the indication of the number of PCR cycles used in the experiments. Finally, AF_SOL_# denotes the sequencing run ID number.

Project description:Synthetic DNA-binding proteins have found broad application in gene therapies and as tools for interrogating biology. Engineered proteins based on the CRISPR/Cas9 and TALE systems have been used to alter genomic DNA sequences, control transcription of endogenous genes, and modify epigenetic states. Although the activity of these proteins at their intended genomic target sites have been assessed, the genome-wide effects of their action have not been extensively characterized. Additionally, the role of chromatin structure in determining the binding of CRISPR/Cas9 and TALE proteins to their target sites and the regulation of nearby genes is poorly understood. Characterization of the activity these proteins using modern high-throughput genomic methods would provide valuable insight into the specificity and off-target effects of CRISPR- and TALE-based genome engineering tools. We have analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators targeted to the promoters of two different endogenous human genes in HEK293T cells using a variety of high-throughput DNA sequencing methods. In particular, we assayed the DNA-binding specificity of these proteins and their effects on the epigenome. DNA-binding specificity was evaluated by ChIP-seq and RNA-seq was used to measure the specificity of these activators in perturbing the transcriptome. Additionally, DNase-seq was used to identify the chromatin state at target sites of the synthetic transcriptional activators and the genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these genome engineering technologies are highly specific in both binding to their promoter target sites and inducing expression of downstream genes when multiple activators bind to a single promoter. Moreover, we show that these synthetic activators are able to induce the expression of silent genes in heterochromatic regions of the genome by opening regions of closed chromatin and decreasing DNA methylation. Interestingly, the transcriptional activation domain was not necessary for DNA-binding or chromatin remodeling in these regions, but was critical to inducing gene expression. This study shows that these CRISPR- and TALE-based transcriptional activators are exceptionally specific. Although we detected limited binding of off-target sites in the genome and changes to genome structure, these off-target event did not lead to any detectable changes in gene regulation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. HEK293T cells were transfected in triplicate with plasmids expressing synthetic transcription factors. The synthetic TFs were either (a) dCas9-VP64 fusion protein and a targeting guide RNA (gRNA), or (b) a TALE-VP64 fusion protein engineered to bind to a specific target site in the genome. As a control, cells were transfected with plasmids expressing GFP. After transfection, ChIP-seq was used to identify both on-target and off-target binding sites for the synthetic TFs.

Dataset Information

A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture

Publications

A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure