Genome-Wide Specificity of DNA-Binding, Gene Regulation, and Chromatin Remodeling by TALE- and CRISPR/Cas9-Based Transcription Factors
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Greg Crawford
PROVIDER: E-GEOD-67007 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Synthetic DNA-binding proteins have found broad application in gene therapies and as tools for interrogating biology. Engineered proteins based on the CRISPR/Cas9 and TALE systems have been used to alter genomic DNA sequences, control transcription of endogenous genes, and modify epigenetic states. Although the activity of these proteins at their intended genomic target sites have been assessed, the genome-wide effects of their action have not been extensively characterized. Additionally, the role of chromatin structure in determining the binding of CRISPR/Cas9 and TALE proteins to their target sites and the regulation of nearby genes is poorly understood. Characterization of the activity these proteins using modern high-throughput genomic methods would provide valuable insight into the specificity and off-target effects of CRISPR- and TALE-based genome engineering tools. We have analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators targeted to the promoters of two different endogenous human genes in HEK293T cells using a variety of high-throughput DNA sequencing methods. In particular, we assayed the DNA-binding specificity of these proteins and their effects on the epigenome. DNA-binding specificity was evaluated by ChIP-seq and RNA-seq was used to measure the specificity of these activators in perturbing the transcriptome. Additionally, DNase-seq was used to identify the chromatin state at target sites of the synthetic transcriptional activators and the genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these genome engineering technologies are highly specific in both binding to their promoter target sites and inducing expression of downstream genes when multiple activators bind to a single promoter. Moreover, we show that these synthetic activators are able to induce the expression of silent genes in heterochromatic regions of the genome by opening regions of closed chromatin and decreasing DNA methylation. Interestingly, the transcriptional activation domain was not necessary for DNA-binding or chromatin remodeling in these regions, but was critical to inducing gene expression. This study shows that these CRISPR- and TALE-based transcriptional activators are exceptionally specific. Although we detected limited binding of off-target sites in the genome and changes to genome structure, these off-target event did not lead to any detectable changes in gene regulation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. HEK293T cells were transfected in triplicate with plasmids expressing synthetic transcription factors. The synthetic TFs were either (a) dCas9-VP64 fusion protein and a targeting guide RNA (gRNA), or (b) a TALE-VP64 fusion protein engineered to bind to a specific target site in the genome. As a control, cells were transfected with plasmids expressing GFP. After transfection, RNA-seq was used to identify both on-target and off-target binding sites for the synthetic TFs. The data in this submission were generated using the TALE transfection experiments.
2015-05-27 | E-GEOD-68341 | biostudies-arrayexpress
Project description:Synthetic DNA-binding proteins have found broad application in gene therapies and as tools for interrogating biology. Engineered proteins based on the CRISPR/Cas9 and TALE systems have been used to alter genomic DNA sequences, control transcription of endogenous genes, and modify epigenetic states. Although the activity of these proteins at their intended genomic target sites have been assessed, the genome-wide effects of their action have not been extensively characterized. Additionally, the role of chromatin structure in determining the binding of CRISPR/Cas9 and TALE proteins to their target sites and the regulation of nearby genes is poorly understood. Characterization of the activity these proteins using modern high-throughput genomic methods would provide valuable insight into the specificity and off-target effects of CRISPR- and TALE-based genome engineering tools. We have analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators targeted to the promoters of two different endogenous human genes in HEK293T cells using a variety of high-throughput DNA sequencing methods. In particular, we assayed the DNA-binding specificity of these proteins and their effects on the epigenome. DNA-binding specificity was evaluated by ChIP-seq and RNA-seq was used to measure the specificity of these activators in perturbing the transcriptome. Additionally, DNase-seq was used to identify the chromatin state at target sites of the synthetic transcriptional activators and the genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these genome engineering technologies are highly specific in both binding to their promoter target sites and inducing expression of downstream genes when multiple activators bind to a single promoter. Moreover, we show that these synthetic activators are able to induce the expression of silent genes in heterochromatic regions of the genome by opening regions of closed chromatin and decreasing DNA methylation. Interestingly, the transcriptional activation domain was not necessary for DNA-binding or chromatin remodeling in these regions, but was critical to inducing gene expression. This study shows that these CRISPR- and TALE-based transcriptional activators are exceptionally specific. Although we detected limited binding of off-target sites in the genome and changes to genome structure, these off-target event did not lead to any detectable changes in gene regulation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. HEK293T cells were transfected in triplicate with plasmids expressing synthetic transcription factors. The synthetic TFs were either (a) dCas9-VP64 fusion protein and a targeting guide RNA (gRNA), or (b) a TALE-VP64 fusion protein engineered to bind to a specific target site in the genome. As a control, cells were transfected with plasmids expressing GFP. After transfection, ChIP-seq was used to identify both on-target and off-target binding sites for the synthetic TFs.
2015-04-24 | E-GEOD-57085 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Dissection of catalytic and non-catalytic functions of Tet1. DNA methylation (RRBS) profiling of wild type, Tet1 knockout and catalytic mutants during EpiLC differentiation.
2020-09-30 | E-MTAB-6785 | biostudies-arrayexpress
Project description:Tau (MAPT) is a microtubule-associated protein causing frequent neurodegenerative diseases or inherited frontotemporal lobar degenerations. Emerging evidence for non-canonical functions of Tau in DNA protection and P53 regulation suggests its involvement in cancer. Indeed, Tau expression correlates with cancer-specific survival or response to microtubule therapeutics. These data may imply common molecular pathways involved in the pathogenesis of neurodegenerative disorders and cancer. To bring new evidence that Tau represents a key protein in cancer, we present an in silico pan-cancer analysis of MAPT transcriptomic profile in over 11000 clinical samples and over 1300 pre-clinical samples provided by the TCGA and the DEPMAP datasets respectively. We completed this analysis by exploring a possible interplay of MAPT with wild-type or mutated P53. Then, we calculated the impact of MAPT expression on clinical outcome and drug response. Overall, the results support a relevant role of the MAPT gene in several cancer types, although the contribution of Tau to cancer appears to very much depend on the cellular context.
2022-11-27 | E-MTAB-8166 | biostudies-arrayexpress
Project description:Chromatin accessibility was assayed in ESC after epigenetic editing with dCas9::KRAB (or dCas9::GFP as a control) and subsequently in ESC and Endoderm differentiated cells upon release of the trigger. Samples were collected in two biological replicates after 7 days of DOX induction in ESC (epigenetic editing) and after 7 days of DOX washout (release of the trigger) in ESC and Endoderm cells.
2021-11-23 | E-MTAB-10523 | biostudies-arrayexpress
Project description:Chromatin accessibility was assayed in wildtype or Dppa2 knockout ESC after 26 days of release of the trigger imposed by epigenetic editing. Samples were collected in two clonal knockout and wildtype lines after sorting at FACS of cells which maintained a repressive Esg1-tdTomato (TOMneg) reporter expression after 26 days of DOX washout (release of the trigger).
2021-11-23 | E-MTAB-10522 | biostudies-arrayexpress
Project description:Zbtb2 binds to Zfp639 and Ubn2. To determine if these mediate Zbtb2’s transcriptional function we performed RNA-seq of wildtype, Zbtb2, Zfp639 and Ubn2 mutant cells; in the naïve pluripotent state in 2iLIF, and after 48h of exposure to SerumLIF.
2021-07-07 | E-MTAB-9798 | biostudies-arrayexpress
Project description:A genome-wide CRISPR screen was combined with a tdTomato reporter-based epigenetic memory assay to identify factors that erase epigenetic memory in ESC. After introducing genome wide perturbation and dCas9::KRAB-mediated epigenetic editing of the Esg1-tdTomato reporter, the trigger was released and cells that maintained the silencing sorted at FACS. Samples were collected out of sorted tdTomato negative (TOMminus) and positive (TOMplus) cells after 6 days of DOX treatment (epigenetic editing) and 3 or 7 days of DOX washout (release of the trigger), using a gating strategy to separate the bottom 2.5% negative cells (2.5%gate) and cells ranging from mildly to fully repressed (widegate).
2021-11-23 | E-MTAB-10524 | biostudies-arrayexpress
Project description:Dissection of catalytic and non-catalytic functions of Tet1 and Tet2. Transcriptome profiling of wild type, Tet1 catalytic mutants, Tet2 and Tet1/2 catalytic mutant catalytic during EpiLC differentiation.
2020-10-05 | E-MTAB-6797 | biostudies-arrayexpress