RNA-sequencing analysis of liver from mice overexpressing miR-30c
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
SUBMITTER: Bailey Peck
PROVIDER: E-GEOD-70352 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Comparative analysis of the transcriptome of primary tumors generated from 4T1 cells transduced with a lentiviral vector expressing a siRNA against murine SPARC (4T1-C18), primary tumors generated from 4T1 cells transduced with a lentiviral vector expressing a scramble sequence (4T1-SCR) or lung metastasis foci from 4T1-SCR tumor-bearing mice (4T1-SCR MTTS). Three experimental conditions, 4T1-C18, 4T1-SCR and 4T1-SCR MTTS. Biological replicates: 4 4T1-C18, 4 4T1-SCR, 4 4T1-SCR MTTS independently grown in different mice. 2 days-old tumors and 30 days old lung foci. One replicate per array. All microarrays were processed the same day
2016-06-29 | E-GEOD-83831 | biostudies-arrayexpress
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
2014-02-22 | E-GEOD-55261 | biostudies-arrayexpress
Project description:We performed a high-throughput, multiplexed quantitative proteomics analysis to determine protein abundance changes produced by BML-111 treatment in EAM and Ctrl mice. EAM was induced in 7 weeks-old BALB/c female mice by immunization at days 0 and 7 with a subcutaneous injection of 350 μg of murine cardiac myosin (MyHCα) in a 1:1 emulsion with complete Freund’s Adjuvant (SIGMA). MyHCα was isolated from hearts of Balb/c mice; control mice were injected with a 1:1 emulsion of physiological saline solution with complete Freund’s Adjuvant. Mice were treated daily for two weeks from day 7 by intraperitoneal injection with two complementary treatments: 1mg/Kg BML-111(Enzo Life Science) or its vehicle (2.5% ethanol). The proteomics analysis was performed in heart tissue protein extracts (four animals per group: Ctrl+Veh, EAM+Veh, Ctrl+BML and EAM+BML.
2022-12-07 | PXD024345 | Pride
Project description:The age and sex of studied animals profoundly impacts experimental outcomes in animal-based biomedical research. However, most preclinical studies in mice use a wide-spanning age range from 4 to 14 weeks and do not assess study parameters in male and female mice in parallel. This raises concerns regarding reproducibility and neglect of potentially relevant age and sex differences. Furthermore, the molecular setup of tissues in dependence of age and sex is unknown in naïve mice precluding efficient translational research. Here, we first compared two different mass spectrometric acquisition methods – DDA- and DIA-PASEF – in order to maximize the depth of proteome quantitation. We then employed an optimized workflow of quantitative proteomics based on DIA-PASEF followed by DIA-NN data analysis, and revealed significant differences in mouse paw skin and sciatic nerve (SCN) when comparing (i) male and female mice, and, in parallel, (ii) adolescent mice (4 weeks) with adult mice (14 weeks).
2022-11-29 | PXD034476 | Pride
Project description:To screen the microRNA regulated by Twist1 and Bmi1 Establish stable transfectants of pSUPER-sh-Twist1 or pSUPER-sh-Bmi1 in OECM1 cells and analyze the miRNA expression level of by microRNA microarray. OECM1 transfected with pSUPER-sh-scr was used as a control experiment.
2013-02-11 | E-GEOD-29586 | biostudies-arrayexpress
Project description:Here we investigated the longterm carryover effects of dichloroacetic acid (DCA), a common by-product of drinking water chlorination, on hepatic tumorigenesis in mice. Our findings demonstrate that postnatal exposure to a common drinking water contaminant results in longterm carryover effects on tumorigenesis, potentially via epigenetic events altering cellular respiration and metabolism. The gene expression study followed a stop-promotion design in which 7d male B6C3F1 mice received the following treatments: deionized water alone (dH2O, control); 0.06% phenobarbital (PB), a rodent liver mitogen and tumor promoter; or DCA (3.5g/L) for 10 weeks followed by dH2O for 90 weeks.
2015-02-26 | E-GEOD-58585 | biostudies-arrayexpress
Project description:Southern corn rust (SCR) is one of destructive diseases in maize caused by Puccinia polysora Undrew. (P. polysara), widely occurring in warm-temperate and tropical regions globally. To identify candidate SCR resistance-related proteins and understand the molecular mechanism underlaying the maize and P. polysara interaction, comparative proteomic analysis of susceptible and resistance maize lines was performed. A total of 6,612 proteins were successfully identified using an iTRAQ-based proteomic approach. Fold changes and statistical analysis demonstrated that 687 proteins increased and 802 proteins decreased in the resistant line, while 571 increased and 464 decreased in the susceptible line. One remorin protein, namely ZmREM1.3 (B4G1B0), was significantly induced by SCR in the resistant genotype, while decreased in susceptible genotype after P. polysara infection. Plant-specific remorin proteins have been shown to play important roles during microbial infection and plant signaling processes. Transgenic analysis showed that overexpression of ZmREM1.3 in maize confers enhanced resistance to the biotrophic fungal pathogen SCR. Upon pathogen challenge, the ZmREM1.3-overexpressing plants accumulated higher levels of defense hormones, SA and JA. Moreover, stronger induction of defense gene expression was also observed in ZmREM1.3-overexpressing maize plants in response to SCR infection. Taken together, our results support that ZmREM1.3 plays a positive role in regulating the maize defense against SCR likely through SA/JA-mediated defense signaling pathways. This is the first attempt for large scale analysis of the molecular mechanisms underlaying the maize and P. polysara interaction at the proteomic level, and the first evidence for remorin protein family in resistant to fungal disease.
2019-04-18 | PXD008904 | Pride
Project description:The phosphorylomics data of liver tissue of 16-week-old HFHC-induced mice treated with saline or breviscapine for 8 weeks. The mice fed with high fat and high cholesterol were also divided into two groups. The control group was treated with normal saline for 8W, and the drug group was treated with breviscapine for 8W n=3.
2022-08-12 | PXD029975 | Pride
Project description:Dietary supplementation of vitamin D is commonly recommended to patients with multiple sclerosis (MS). We investigated the effect of 1,25-dihydroxyvitamin-D3 (1,25-(OH)2D3) on the brain proteome in the cuprizone model during remyelination. Mice were demyelinated with dietary cuprizone for 7 weeks. The mice received intra-peritoneal injections of 1,25-(OH)2D3 or placebo twice a week, from week 6 and throughout week 10. Brain samples were taken after 7 weeks (demyelinated), after 8 weeks (1 week remyelination) and after 10 weeks (3 weeks of remyelination). The six experimental groups were labeled with TMT, mixed mode HPLC fractionation, and applied to LC-MS which enabled quantification of 5062 proteins with high confidence.
2017-08-16 | PXD002347 | Pride
Project description:Although internal PolyA RNA modification N6-methyladenosine (m6A) plays essential roles in diverse biological processes, technology to detect precise m6A sites at transcriptome-wide scale is lacking. Here, we discovered that m6A interferes A (Adenine) – U (Uracil) or A-T (Thymidine) pairing. Based on differential hybridization between methylated vs. unmethylated RNAs to a DNA probe, we developed tiling microarray to pinpoint m6A sites in mouse transcriptome. We validated some of the identified sites and provided evidence to suggest that one functional mechanism of m6A is to block small RNA targeting to methylated mRNA. We designed a custom tiling array with to examine the precise location of m6A within meRIP-seq peaks from mouse embryonic stem cells determined in our previous publication (Wang et al., 2014). Each custom two-channel Agilent tiling array harbors 947,952 probes. Each probe is 25 nucleotides (nt), and any two adjacent probes in the genomic coordinate overlap each other by 19 nt. The Cy5 or red channel corresponds to Mettl14 knockout (M14) or DZA mutant mESC cell line, and Cy3 or green channel is associated with wild type cell line treated with scramble hairpin (SCR). Thus, in principle a higher Cy5/Cy3 signal for each probe reflects an increased hybridization to the oligonucleotide due to de-methylation of a particular RNA molecule in M14 or DZA condition relative to the SCR control. Moreover, we employed additional arrays with both channels dedicated for M14 as an external control for technical difference between the Cy5 and Cy3 dye (details below). For each comparison, we have three biological replicates, and therefore there are 9 tiling arrays in total (i.e., 3 arrays for M14 vs SCR, 3 arrays for DZA vs SCR, and 3 arrays for M14 vs M14).
2015-09-08 | E-GEOD-62530 | biostudies-arrayexpress